Incidental Mutation 'R4996:Ranbp9'
ID385282
Institutional Source Beutler Lab
Gene Symbol Ranbp9
Ensembl Gene ENSMUSG00000038546
Gene NameRAN binding protein 9
SynonymsRanBPM, IBAP-1
MMRRC Submission 042590-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R4996 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location43402675-43481282 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 43425094 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 168 (Q168*)
Ref Sequence ENSEMBL: ENSMUSP00000152620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000144326] [ENSMUST00000222239] [ENSMUST00000222651]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083381
Predicted Effect probably null
Transcript: ENSMUST00000144326
AA Change: Q332*
SMART Domains Protein: ENSMUSP00000130636
Gene: ENSMUSG00000038546
AA Change: Q332*

DomainStartEndE-ValueType
low complexity region 2 114 N/A INTRINSIC
SPRY 194 315 1.66e-43 SMART
LisH 347 379 6.82e-5 SMART
CTLH 385 442 9.78e-15 SMART
low complexity region 455 478 N/A INTRINSIC
CRA 596 698 1.6e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220529
Predicted Effect probably benign
Transcript: ENSMUST00000222239
Predicted Effect probably null
Transcript: ENSMUST00000222651
AA Change: Q168*
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds RAN, a small GTP binding protein belonging to the RAS superfamily that is essential for the translocation of RNA and proteins through the nuclear pore complex. The protein encoded by this gene has also been shown to interact with several other proteins, including met proto-oncogene, homeodomain interacting protein kinase 2, androgen receptor, and cyclin-dependent kinase 11. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display partial neonatal lethality. Survivors display infertility with impaired spermatogenesis and oogenesis, azoospermia and premature ovarian failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Actl11 A G 9: 107,931,735 I1086V possibly damaging Het
Adgrv1 T C 13: 81,578,734 S500G probably benign Het
Ahcyl1 A T 3: 107,668,287 V394E probably damaging Het
Alg9 T C 9: 50,808,705 F494L probably damaging Het
Ankrd55 C A 13: 112,356,088 D264E possibly damaging Het
Asb14 A G 14: 26,912,116 N426S possibly damaging Het
Atm A T 9: 53,524,507 F168I probably benign Het
Atp13a4 A T 16: 29,472,004 I209N probably damaging Het
BB014433 A T 8: 15,042,166 L229Q probably benign Het
C130026I21Rik G T 1: 85,247,094 A240E probably benign Het
Calml3 T C 13: 3,804,142 D21G probably damaging Het
Capn10 A G 1: 92,945,136 N528S probably damaging Het
Ccnl2 T A 4: 155,813,524 D141E possibly damaging Het
Cd163 A G 6: 124,319,147 I817V probably benign Het
Cgnl1 CTTGCCCAGGTT CTT 9: 71,724,826 probably benign Het
Cln6 T A 9: 62,850,655 I232N probably damaging Het
Col22a1 A C 15: 72,007,161 V49G probably damaging Het
Csmd1 A T 8: 15,910,452 M3321K probably damaging Het
Cyp2u1 T A 3: 131,298,284 M196L probably benign Het
Dlec1 T G 9: 119,146,050 L1566R probably damaging Het
Dnajc3 A G 14: 118,972,427 T305A probably benign Het
Drp2 G A X: 134,441,316 R567H probably damaging Homo
Efhd1 G T 1: 87,264,558 G37W possibly damaging Het
Exph5 G C 9: 53,375,610 E1330D possibly damaging Het
Fam207a A T 10: 77,515,533 W14R probably null Het
Fbln2 A T 6: 91,266,010 Y913F probably benign Het
Fmnl1 G A 11: 103,182,656 S167N possibly damaging Het
Frs3 A G 17: 47,701,710 E114G probably damaging Het
Gm960 T A 19: 4,626,084 K673N probably benign Het
Gmpr2 T C 14: 55,676,795 I169T probably damaging Het
Gria2 A G 3: 80,707,141 S531P probably damaging Het
Hace1 G A 10: 45,649,950 A296T probably benign Het
Hrasls G A 16: 29,217,704 W31* probably null Het
Inhbb A C 1: 119,420,818 L90R probably damaging Het
Insr C T 8: 3,192,665 R18Q probably null Het
Kdm6b G T 11: 69,405,731 P570Q probably damaging Het
Lama3 T C 18: 12,518,743 V1803A probably benign Het
Lpin3 T A 2: 160,905,287 L811Q probably damaging Het
Lrrc8e C T 8: 4,235,166 L464F probably damaging Het
Micall2 A G 5: 139,710,589 S729P probably benign Het
Naca C T 10: 128,042,429 probably benign Het
Nav1 A T 1: 135,465,971 S1010T probably damaging Het
Nefm T C 14: 68,121,121 probably benign Het
Nlrp9c A T 7: 26,385,747 F136I possibly damaging Het
Nup210 A T 6: 91,053,436 F137Y probably benign Het
Olfr1079 T C 2: 86,538,271 I215V probably benign Het
Olfr402 A G 11: 74,155,331 H59R probably damaging Het
Olfr98 A G 17: 37,262,867 S266P probably benign Het
Otog C A 7: 46,298,606 H2344N possibly damaging Het
Otog C A 7: 46,305,510 C517* probably null Het
Pcdhac1 C T 18: 37,092,527 Q798* probably null Het
Pdhx T C 2: 103,030,312 D330G probably damaging Het
Peg10 ACATCAGGATCC ACATCAGGATCCCCATCAGGATCC 6: 4,756,454 probably benign Het
Pgr C A 9: 8,900,913 P149Q probably damaging Het
Ppm1h A T 10: 122,941,340 I504F probably damaging Het
Ppp6r3 A G 19: 3,473,833 S556P probably damaging Het
Relb A T 7: 19,615,603 L259Q probably benign Het
Rfx5 G A 3: 94,955,815 V73I probably benign Het
Rgcc T C 14: 79,290,276 D125G possibly damaging Het
Rmnd5b A G 11: 51,627,908 V86A probably damaging Het
Slc15a5 G A 6: 138,043,585 T250M probably damaging Het
Slc7a2 A T 8: 40,912,562 K477* probably null Het
Smc2 T A 4: 52,461,042 probably null Het
Sox5 A T 6: 144,028,344 L226* probably null Het
Syne2 A G 12: 75,943,950 E1903G possibly damaging Het
Tenm3 A T 8: 48,235,826 I2226N probably damaging Het
Tmtc3 A T 10: 100,447,224 I823N probably damaging Het
Tor3a T C 1: 156,655,772 Y360C probably damaging Het
Trpc3 T C 3: 36,662,818 E357G probably benign Het
Ttc30a1 C T 2: 75,979,922 G606S probably benign Het
Tubgcp6 A T 15: 89,103,490 N1093K possibly damaging Het
Vmn1r64 T A 7: 5,884,053 T164S probably benign Het
Vmn2r40 T A 7: 8,908,167 Q709L probably damaging Het
Vmn2r81 A T 10: 79,293,413 I713L probably benign Het
Washc5 T C 15: 59,333,635 T686A probably benign Het
Wipf1 GCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCC 2: 73,440,074 probably benign Het
Other mutations in Ranbp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Ranbp9 APN 13 43480504 missense probably damaging 1.00
IGL01478:Ranbp9 APN 13 43414084 missense probably benign 0.31
IGL01948:Ranbp9 APN 13 43422553 missense probably damaging 1.00
IGL02177:Ranbp9 APN 13 43419717 missense probably damaging 0.99
IGL02382:Ranbp9 APN 13 43436146 splice site probably null
R0183:Ranbp9 UTSW 13 43425123 missense probably damaging 1.00
R0401:Ranbp9 UTSW 13 43422658 missense probably damaging 1.00
R0771:Ranbp9 UTSW 13 43461773 missense possibly damaging 0.92
R1551:Ranbp9 UTSW 13 43425117 missense probably benign 0.15
R1644:Ranbp9 UTSW 13 43412539 missense probably damaging 1.00
R1892:Ranbp9 UTSW 13 43416457 missense possibly damaging 0.87
R2247:Ranbp9 UTSW 13 43412425 missense probably damaging 1.00
R4097:Ranbp9 UTSW 13 43421257 missense probably damaging 0.97
R4794:Ranbp9 UTSW 13 43414076 missense probably damaging 0.99
R4908:Ranbp9 UTSW 13 43421257 missense possibly damaging 0.81
R5024:Ranbp9 UTSW 13 43434855 missense probably damaging 0.99
R5422:Ranbp9 UTSW 13 43419626 missense probably benign 0.01
R7069:Ranbp9 UTSW 13 43419622 missense probably benign 0.24
R7115:Ranbp9 UTSW 13 43406671 missense probably benign 0.04
R7298:Ranbp9 UTSW 13 43480460 missense probably benign 0.10
R7382:Ranbp9 UTSW 13 43425114 missense probably damaging 0.99
R7826:Ranbp9 UTSW 13 43419621 missense possibly damaging 0.46
X0024:Ranbp9 UTSW 13 43425085 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TCTGAGGGTGCTTAAACCAATGC -3'
(R):5'- AAGGCAATGAAGTCCTTAGTGTAC -3'

Sequencing Primer
(F):5'- GGGTGCTTAAACCAATGCTATTTTAC -3'
(R):5'- GGTTGATGCCAACTTTGG -3'
Posted On2016-05-10