Incidental Mutation 'R4997:Cep152'
Institutional Source Beutler Lab
Gene Symbol Cep152
Ensembl Gene ENSMUSG00000068394
Gene Namecentrosomal protein 152
MMRRC Submission 042591-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4997 (G1)
Quality Score225
Status Not validated
Chromosomal Location125563088-125625113 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125586351 bp
Amino Acid Change Threonine to Alanine at position 787 (T787A)
Ref Sequence ENSEMBL: ENSMUSP00000087208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089776]
Predicted Effect probably benign
Transcript: ENSMUST00000089776
AA Change: T787A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000087208
Gene: ENSMUSG00000068394
AA Change: T787A

low complexity region 15 29 N/A INTRINSIC
low complexity region 106 124 N/A INTRINSIC
coiled coil region 228 481 N/A INTRINSIC
low complexity region 582 593 N/A INTRINSIC
coiled coil region 602 651 N/A INTRINSIC
coiled coil region 692 770 N/A INTRINSIC
low complexity region 780 793 N/A INTRINSIC
coiled coil region 835 868 N/A INTRINSIC
coiled coil region 954 1038 N/A INTRINSIC
coiled coil region 1205 1277 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is thought to be involved with centrosome function. Mutations in this gene have been associated with primary microcephaly (MCPH4). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2010]
PHENOTYPE: Embryos homozygous for a null allele exhibit reduced numbers of centrosomes and cilia, increased apoptosis, and midgestation lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T G 7: 28,143,924 S746A possibly damaging Het
A630023A22Rik A T 14: 34,053,666 M1L probably benign Het
Abca7 C A 10: 80,007,320 Q1210K possibly damaging Het
Abcc4 C T 14: 118,516,503 W1024* probably null Het
Accs A T 2: 93,841,883 Y213* probably null Het
Adam6a G T 12: 113,545,371 G455C probably damaging Het
Adcy1 A C 11: 7,161,298 Y863S probably benign Het
Adgrg1 A G 8: 95,009,520 D434G probably damaging Het
Afap1l1 C T 18: 61,751,808 R202Q probably benign Het
Aldh3a1 T C 11: 61,212,311 V27A probably benign Het
Antxr2 A G 5: 97,977,694 F235L probably benign Het
Arhgap23 T A 11: 97,452,020 V376E probably damaging Het
Brca1 A C 11: 101,524,333 S992A probably damaging Het
Calcrl A T 2: 84,351,248 C185* probably null Het
Coch T A 12: 51,603,181 probably null Het
Col5a1 T A 2: 28,032,782 Y287* probably null Het
Dis3l A G 9: 64,311,942 S569P possibly damaging Het
Dnaic1 A G 4: 41,597,919 I74V possibly damaging Het
Dpy19l4 A G 4: 11,287,493 V394A probably benign Het
Egfem1 A G 3: 29,153,590 H122R probably benign Het
Endou A G 15: 97,719,577 L164P probably damaging Het
Epgn A G 5: 91,032,239 E80G possibly damaging Het
Fitm1 T C 14: 55,576,907 S287P probably benign Het
Foxm1 A G 6: 128,365,768 N22D probably benign Het
Gm5136 A G 10: 108,699,788 I102T probably benign Het
Gsdmc A T 15: 63,776,780 M426K probably damaging Het
Hmcn2 T A 2: 31,401,708 V2418D probably damaging Het
Hs3st2 T A 7: 121,500,456 L175Q possibly damaging Het
Il1r2 T C 1: 40,121,046 probably null Het
Il27ra A T 8: 84,039,527 Y209* probably null Het
Inpp5a A T 7: 139,400,738 S31C probably benign Het
Invs A G 4: 48,396,332 D335G probably damaging Het
Isg15 C T 4: 156,199,697 E125K possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lama4 C A 10: 39,092,266 T1468K probably damaging Het
Lce1a2 A G 3: 92,669,088 S56P unknown Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lmf1 G A 17: 25,588,676 W164* probably null Het
Mad2l1bp G T 17: 46,152,878 C73* probably null Het
Mpzl1 A C 1: 165,601,781 V230G probably damaging Het
Myo3b A G 2: 70,258,083 T869A possibly damaging Het
Ncor2 T C 5: 125,034,010 H1316R probably damaging Het
Nlrp1b T A 11: 71,218,334 I114F probably damaging Het
Nsun7 A G 5: 66,295,839 I632M probably benign Het
Nubp1 T C 16: 10,421,321 I234T probably benign Het
Olfml1 A G 7: 107,571,206 D100G probably damaging Het
Olfr22-ps1 T A 11: 73,954,786 L32Q probably damaging Het
Olfr498 C A 7: 108,465,494 Q57K probably benign Het
Olfr839-ps1 A T 9: 19,175,331 L115Q probably damaging Het
Osmr G T 15: 6,815,639 P882Q probably benign Het
Peg10 TCAGGATCC TCAGGATCCCCAGCAGGATCC 6: 4,756,457 probably benign Het
Per2 T A 1: 91,450,783 T15S probably benign Het
Piezo2 A G 18: 63,083,113 Y1184H probably damaging Het
Pik3c2b C T 1: 133,105,081 A1560V probably damaging Het
Pik3cd A C 4: 149,658,984 L256R probably damaging Het
Ppl C A 16: 5,089,371 R1020L probably damaging Het
Ppp1r10 A G 17: 35,924,084 N60S probably damaging Het
Prkcg T C 7: 3,322,581 probably null Het
Prkci T C 3: 31,031,226 probably null Het
Prrc2b A G 2: 32,222,311 Y1929C probably damaging Het
Prss12 T C 3: 123,447,208 V17A probably benign Het
Qtrt1 A G 9: 21,417,358 N206S probably benign Het
Rad54l2 A C 9: 106,722,909 S50A possibly damaging Het
Rhov C T 2: 119,270,468 R96H probably damaging Het
Rph3a A T 5: 120,963,843 V110E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 A T 13: 11,595,306 N646K probably benign Het
Scn8a A G 15: 100,957,054 T141A probably damaging Het
Serping1 T C 2: 84,770,285 R238G possibly damaging Het
Shank3 T A 15: 89,549,698 W1474R probably damaging Het
Slc16a12 T A 19: 34,674,958 M263L probably benign Het
Spata13 T C 14: 60,709,459 V652A probably damaging Het
Spata31 G A 13: 64,919,723 M66I probably benign Het
Spem2 T C 11: 69,817,732 I136V probably benign Het
Supt5 T C 7: 28,316,037 H925R probably benign Het
Syk A T 13: 52,612,448 K190* probably null Het
Thsd1 T A 8: 22,243,324 V129D probably damaging Het
Tiprl A G 1: 165,220,190 V174A possibly damaging Het
Tmed4 T A 11: 6,274,500 probably null Het
Tnfrsf19 T C 14: 60,971,209 T288A probably benign Het
Tnfrsf25 T C 4: 152,117,696 probably null Het
Tpd52 A G 3: 8,934,996 L121S probably damaging Het
Trim30a T A 7: 104,411,620 K316N probably benign Het
Ttc3 T G 16: 94,452,982 D1221E probably damaging Het
Ttn C T 2: 76,884,059 probably benign Het
Ttn T C 2: 76,946,271 I1514V probably benign Het
Ulk2 T C 11: 61,799,156 T671A probably benign Het
Wasf1 C T 10: 40,934,604 P281S probably damaging Het
Wnt10b C A 15: 98,774,203 R211L probably damaging Het
Xpnpep3 T A 15: 81,448,376 C371* probably null Het
Zfp41 C T 15: 75,618,768 probably benign Het
Zfp553 T A 7: 127,235,511 N79K probably benign Het
Zmynd8 G T 2: 165,792,816 D1096E probably benign Het
Other mutations in Cep152
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Cep152 APN 2 125563888 missense probably benign 0.01
IGL00561:Cep152 APN 2 125563723 nonsense probably null
IGL01082:Cep152 APN 2 125569545 splice site probably benign
IGL01420:Cep152 APN 2 125563652 missense possibly damaging 0.49
IGL01832:Cep152 APN 2 125618494 nonsense probably null
IGL02106:Cep152 APN 2 125602936 splice site probably null
IGL02124:Cep152 APN 2 125563461 missense probably benign 0.23
IGL02349:Cep152 APN 2 125594956 missense probably damaging 0.99
IGL02541:Cep152 APN 2 125605354 missense probably damaging 1.00
IGL02659:Cep152 APN 2 125579549 missense probably damaging 0.96
IGL02711:Cep152 APN 2 125563942 missense possibly damaging 0.93
IGL02737:Cep152 APN 2 125586474 missense possibly damaging 0.71
IGL03060:Cep152 APN 2 125619987 splice site probably benign
IGL03095:Cep152 APN 2 125618451 missense probably benign 0.00
IGL03186:Cep152 APN 2 125563975 missense probably benign
IGL03306:Cep152 APN 2 125605408 missense possibly damaging 0.90
R0034:Cep152 UTSW 2 125583893 missense probably benign 0.00
R0034:Cep152 UTSW 2 125583893 missense probably benign 0.00
R0079:Cep152 UTSW 2 125618453 missense possibly damaging 0.92
R0244:Cep152 UTSW 2 125564214 missense probably benign 0.00
R0390:Cep152 UTSW 2 125576869 splice site probably benign
R0462:Cep152 UTSW 2 125583934 missense possibly damaging 0.64
R0480:Cep152 UTSW 2 125581719 missense possibly damaging 0.95
R0595:Cep152 UTSW 2 125595063 missense probably damaging 0.99
R0973:Cep152 UTSW 2 125594899 missense probably benign 0.00
R0973:Cep152 UTSW 2 125594899 missense probably benign 0.00
R1634:Cep152 UTSW 2 125583889 missense probably benign 0.00
R1664:Cep152 UTSW 2 125566254 missense probably benign 0.38
R1693:Cep152 UTSW 2 125566254 missense probably benign 0.38
R1887:Cep152 UTSW 2 125620305 missense probably benign 0.00
R1930:Cep152 UTSW 2 125618371 critical splice donor site probably null
R2178:Cep152 UTSW 2 125580034 splice site probably null
R2225:Cep152 UTSW 2 125581784 missense probably damaging 1.00
R2324:Cep152 UTSW 2 125563462 missense probably benign 0.38
R2416:Cep152 UTSW 2 125564172 nonsense probably null
R2845:Cep152 UTSW 2 125587974 missense probably damaging 1.00
R3753:Cep152 UTSW 2 125625052 unclassified probably benign
R4212:Cep152 UTSW 2 125620001 missense probably benign 0.00
R4304:Cep152 UTSW 2 125563723 nonsense probably null
R4371:Cep152 UTSW 2 125613047 missense probably damaging 1.00
R4399:Cep152 UTSW 2 125587980 missense possibly damaging 0.63
R4536:Cep152 UTSW 2 125602947 splice site probably null
R4713:Cep152 UTSW 2 125587948 missense possibly damaging 0.79
R4777:Cep152 UTSW 2 125564095 missense probably benign 0.29
R4779:Cep152 UTSW 2 125568892 missense possibly damaging 0.52
R4785:Cep152 UTSW 2 125586329 critical splice donor site probably null
R4816:Cep152 UTSW 2 125563754 missense probably damaging 1.00
R4847:Cep152 UTSW 2 125618474 missense possibly damaging 0.62
R4898:Cep152 UTSW 2 125586381 missense probably benign 0.03
R4934:Cep152 UTSW 2 125611096 missense possibly damaging 0.52
R5068:Cep152 UTSW 2 125571816 missense probably benign 0.25
R5183:Cep152 UTSW 2 125566638 missense probably damaging 1.00
R5198:Cep152 UTSW 2 125587624 missense probably benign
R5261:Cep152 UTSW 2 125564205 missense probably benign 0.06
R5272:Cep152 UTSW 2 125611030 missense probably benign 0.27
R5284:Cep152 UTSW 2 125580021 missense probably damaging 1.00
R6029:Cep152 UTSW 2 125563632 missense probably benign 0.44
R6155:Cep152 UTSW 2 125581700 missense probably benign
R6239:Cep152 UTSW 2 125579412 missense probably benign 0.40
R6590:Cep152 UTSW 2 125564370 missense probably damaging 1.00
R6690:Cep152 UTSW 2 125564370 missense probably damaging 1.00
R6754:Cep152 UTSW 2 125587668 missense probably damaging 0.99
R6798:Cep152 UTSW 2 125566527 splice site probably null
R6816:Cep152 UTSW 2 125595027 missense probably damaging 1.00
R6977:Cep152 UTSW 2 125568822 critical splice donor site probably null
R7125:Cep152 UTSW 2 125566673 nonsense probably null
R7146:Cep152 UTSW 2 125614405 missense probably benign 0.06
R7588:Cep152 UTSW 2 125569626 missense probably damaging 1.00
R7852:Cep152 UTSW 2 125590113 missense possibly damaging 0.82
R7883:Cep152 UTSW 2 125613058 missense possibly damaging 0.50
R8047:Cep152 UTSW 2 125564327 missense probably benign 0.10
R8082:Cep152 UTSW 2 125586393 missense probably benign
R8680:Cep152 UTSW 2 125564211 nonsense probably null
R8739:Cep152 UTSW 2 125620055 missense probably benign 0.06
R8744:Cep152 UTSW 2 125594871 critical splice donor site probably null
R8896:Cep152 UTSW 2 125566235 missense possibly damaging 0.55
R8924:Cep152 UTSW 2 125602858 missense possibly damaging 0.91
X0009:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0010:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0011:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0014:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0017:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0021:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0022:Cep152 UTSW 2 125620063 missense probably benign 0.07
X0023:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0028:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0033:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0064:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0067:Cep152 UTSW 2 125614386 missense probably damaging 1.00
Z1176:Cep152 UTSW 2 125583971 missense probably benign 0.23
Z1177:Cep152 UTSW 2 125614324 missense probably benign 0.33
Z1177:Cep152 UTSW 2 125619704 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2016-05-10