Incidental Mutation 'R4997:Nsun7'
ID385334
Institutional Source Beutler Lab
Gene Symbol Nsun7
Ensembl Gene ENSMUSG00000029206
Gene NameNOL1/NOP2/Sun domain family, member 7
Synonyms4921525L17Rik
MMRRC Submission 042591-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4997 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location66259897-66298026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66295839 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 632 (I632M)
Ref Sequence ENSEMBL: ENSMUSP00000144498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031109] [ENSMUST00000159512] [ENSMUST00000159786] [ENSMUST00000160870] [ENSMUST00000162366] [ENSMUST00000201100] [ENSMUST00000202994]
Predicted Effect probably benign
Transcript: ENSMUST00000031109
AA Change: I666M

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000031109
Gene: ENSMUSG00000029206
AA Change: I666M

DomainStartEndE-ValueType
Pfam:Nol1_Nop2_Fmu 394 477 4.2e-7 PFAM
low complexity region 543 555 N/A INTRINSIC
Predicted Effect not run
Transcript: ENSMUST00000131585
AA Change: I589M
Predicted Effect probably benign
Transcript: ENSMUST00000159512
SMART Domains Protein: ENSMUSP00000124807
Gene: ENSMUSG00000029207

DomainStartEndE-ValueType
WW 292 323 1.06e-7 SMART
PTB 394 538 2.87e-41 SMART
PTB 565 695 2.5e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159786
SMART Domains Protein: ENSMUSP00000125211
Gene: ENSMUSG00000029207

DomainStartEndE-ValueType
WW 291 322 1.06e-7 SMART
PTB 414 560 4.29e-40 SMART
PTB 587 717 2.5e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160870
SMART Domains Protein: ENSMUSP00000123978
Gene: ENSMUSG00000029207

DomainStartEndE-ValueType
WW 291 322 1.06e-7 SMART
PTB 393 537 2.87e-41 SMART
PTB 564 694 2.5e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162366
SMART Domains Protein: ENSMUSP00000125116
Gene: ENSMUSG00000029207

DomainStartEndE-ValueType
WW 291 322 1.06e-7 SMART
PTB 393 537 2.87e-41 SMART
PTB 563 693 2.5e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162955
Predicted Effect probably benign
Transcript: ENSMUST00000201100
AA Change: I666M

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000144520
Gene: ENSMUSG00000029206
AA Change: I666M

DomainStartEndE-ValueType
Pfam:Nol1_Nop2_Fmu 312 479 4.3e-9 PFAM
low complexity region 543 555 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201776
Predicted Effect probably benign
Transcript: ENSMUST00000202994
AA Change: I632M

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000144498
Gene: ENSMUSG00000029206
AA Change: I632M

DomainStartEndE-ValueType
PDB:2B9E|A 205 479 5e-17 PDB
low complexity region 509 521 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the NOL1/NOP2/sun domain RNA methyltransferase family. Mice with a mutation in this gene exhibit male sterility due to impaired sperm motility. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Males homozygous for an ENU-induced mutation are either infertile or subfertile. Mutant sperm exhibit poor progressive motility linked to rigidity of the flagellar midpiece and abnormal electron density patterns in the mitochondrial sheath. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T G 7: 28,143,924 S746A possibly damaging Het
A630023A22Rik A T 14: 34,053,666 M1L probably benign Het
Abca7 C A 10: 80,007,320 Q1210K possibly damaging Het
Abcc4 C T 14: 118,516,503 W1024* probably null Het
Accs A T 2: 93,841,883 Y213* probably null Het
Adam6a G T 12: 113,545,371 G455C probably damaging Het
Adcy1 A C 11: 7,161,298 Y863S probably benign Het
Adgrg1 A G 8: 95,009,520 D434G probably damaging Het
Afap1l1 C T 18: 61,751,808 R202Q probably benign Het
Aldh3a1 T C 11: 61,212,311 V27A probably benign Het
Antxr2 A G 5: 97,977,694 F235L probably benign Het
Arhgap23 T A 11: 97,452,020 V376E probably damaging Het
Brca1 A C 11: 101,524,333 S992A probably damaging Het
Calcrl A T 2: 84,351,248 C185* probably null Het
Cep152 T C 2: 125,586,351 T787A probably benign Het
Coch T A 12: 51,603,181 probably null Het
Col5a1 T A 2: 28,032,782 Y287* probably null Het
Dis3l A G 9: 64,311,942 S569P possibly damaging Het
Dnaic1 A G 4: 41,597,919 I74V possibly damaging Het
Dpy19l4 A G 4: 11,287,493 V394A probably benign Het
Egfem1 A G 3: 29,153,590 H122R probably benign Het
Endou A G 15: 97,719,577 L164P probably damaging Het
Epgn A G 5: 91,032,239 E80G possibly damaging Het
Fitm1 T C 14: 55,576,907 S287P probably benign Het
Foxm1 A G 6: 128,365,768 N22D probably benign Het
Gm5136 A G 10: 108,699,788 I102T probably benign Het
Gsdmc A T 15: 63,776,780 M426K probably damaging Het
Hmcn2 T A 2: 31,401,708 V2418D probably damaging Het
Hs3st2 T A 7: 121,500,456 L175Q possibly damaging Het
Il1r2 T C 1: 40,121,046 probably null Het
Il27ra A T 8: 84,039,527 Y209* probably null Het
Inpp5a A T 7: 139,400,738 S31C probably benign Het
Invs A G 4: 48,396,332 D335G probably damaging Het
Isg15 C T 4: 156,199,697 E125K possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lama4 C A 10: 39,092,266 T1468K probably damaging Het
Lce1a2 A G 3: 92,669,088 S56P unknown Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lmf1 G A 17: 25,588,676 W164* probably null Het
Mad2l1bp G T 17: 46,152,878 C73* probably null Het
Mpzl1 A C 1: 165,601,781 V230G probably damaging Het
Myo3b A G 2: 70,258,083 T869A possibly damaging Het
Ncor2 T C 5: 125,034,010 H1316R probably damaging Het
Nlrp1b T A 11: 71,218,334 I114F probably damaging Het
Nubp1 T C 16: 10,421,321 I234T probably benign Het
Olfml1 A G 7: 107,571,206 D100G probably damaging Het
Olfr22-ps1 T A 11: 73,954,786 L32Q probably damaging Het
Olfr498 C A 7: 108,465,494 Q57K probably benign Het
Olfr839-ps1 A T 9: 19,175,331 L115Q probably damaging Het
Osmr G T 15: 6,815,639 P882Q probably benign Het
Peg10 TCAGGATCC TCAGGATCCCCAGCAGGATCC 6: 4,756,457 probably benign Het
Per2 T A 1: 91,450,783 T15S probably benign Het
Piezo2 A G 18: 63,083,113 Y1184H probably damaging Het
Pik3c2b C T 1: 133,105,081 A1560V probably damaging Het
Pik3cd A C 4: 149,658,984 L256R probably damaging Het
Ppl C A 16: 5,089,371 R1020L probably damaging Het
Ppp1r10 A G 17: 35,924,084 N60S probably damaging Het
Prkcg T C 7: 3,322,581 probably null Het
Prkci T C 3: 31,031,226 probably null Het
Prrc2b A G 2: 32,222,311 Y1929C probably damaging Het
Prss12 T C 3: 123,447,208 V17A probably benign Het
Qtrt1 A G 9: 21,417,358 N206S probably benign Het
Rad54l2 A C 9: 106,722,909 S50A possibly damaging Het
Rhov C T 2: 119,270,468 R96H probably damaging Het
Rph3a A T 5: 120,963,843 V110E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 A T 13: 11,595,306 N646K probably benign Het
Scn8a A G 15: 100,957,054 T141A probably damaging Het
Serping1 T C 2: 84,770,285 R238G possibly damaging Het
Shank3 T A 15: 89,549,698 W1474R probably damaging Het
Slc16a12 T A 19: 34,674,958 M263L probably benign Het
Spata13 T C 14: 60,709,459 V652A probably damaging Het
Spata31 G A 13: 64,919,723 M66I probably benign Het
Spem2 T C 11: 69,817,732 I136V probably benign Het
Supt5 T C 7: 28,316,037 H925R probably benign Het
Syk A T 13: 52,612,448 K190* probably null Het
Thsd1 T A 8: 22,243,324 V129D probably damaging Het
Tiprl A G 1: 165,220,190 V174A possibly damaging Het
Tmed4 T A 11: 6,274,500 probably null Het
Tnfrsf19 T C 14: 60,971,209 T288A probably benign Het
Tnfrsf25 T C 4: 152,117,696 probably null Het
Tpd52 A G 3: 8,934,996 L121S probably damaging Het
Trim30a T A 7: 104,411,620 K316N probably benign Het
Ttc3 T G 16: 94,452,982 D1221E probably damaging Het
Ttn C T 2: 76,884,059 probably benign Het
Ttn T C 2: 76,946,271 I1514V probably benign Het
Ulk2 T C 11: 61,799,156 T671A probably benign Het
Wasf1 C T 10: 40,934,604 P281S probably damaging Het
Wnt10b C A 15: 98,774,203 R211L probably damaging Het
Xpnpep3 T A 15: 81,448,376 C371* probably null Het
Zfp41 C T 15: 75,618,768 probably benign Het
Zfp553 T A 7: 127,235,511 N79K probably benign Het
Zmynd8 G T 2: 165,792,816 D1096E probably benign Het
Other mutations in Nsun7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Nsun7 APN 5 66289503 missense probably benign 0.00
IGL01013:Nsun7 APN 5 66283601 missense possibly damaging 0.87
IGL01355:Nsun7 APN 5 66294868 missense probably damaging 1.00
IGL01768:Nsun7 APN 5 66278700 missense probably benign 0.11
IGL01914:Nsun7 APN 5 66276634 missense probably damaging 1.00
IGL01990:Nsun7 APN 5 66261073 missense probably damaging 1.00
IGL02477:Nsun7 APN 5 66276649 missense probably damaging 0.99
R0071:Nsun7 UTSW 5 66264045 missense probably benign 0.00
R0071:Nsun7 UTSW 5 66264045 missense probably benign 0.00
R0079:Nsun7 UTSW 5 66295513 missense probably benign 0.00
R0255:Nsun7 UTSW 5 66289408 splice site probably benign
R0503:Nsun7 UTSW 5 66283581 splice site probably benign
R0540:Nsun7 UTSW 5 66283634 missense probably damaging 0.98
R1416:Nsun7 UTSW 5 66261080 missense probably damaging 0.98
R1471:Nsun7 UTSW 5 66284229 missense probably benign 0.00
R1942:Nsun7 UTSW 5 66284245 missense probably benign 0.00
R1981:Nsun7 UTSW 5 66261214 missense probably damaging 0.99
R2037:Nsun7 UTSW 5 66261086 missense probably benign 0.06
R2098:Nsun7 UTSW 5 66283712 missense probably damaging 0.98
R2226:Nsun7 UTSW 5 66261219 nonsense probably null
R2996:Nsun7 UTSW 5 66295554 missense probably benign 0.01
R3882:Nsun7 UTSW 5 66278640 missense probably damaging 0.99
R4678:Nsun7 UTSW 5 66261064 missense probably benign 0.00
R4681:Nsun7 UTSW 5 66261199 missense probably benign 0.00
R6108:Nsun7 UTSW 5 66295799 missense probably damaging 0.99
R6465:Nsun7 UTSW 5 66295586 missense probably benign 0.35
R6500:Nsun7 UTSW 5 66295484 missense probably benign 0.11
R6746:Nsun7 UTSW 5 66283737 critical splice donor site probably null
R6925:Nsun7 UTSW 5 66277072 missense probably damaging 1.00
R7032:Nsun7 UTSW 5 66264035 missense probably benign 0.02
R7084:Nsun7 UTSW 5 66295421 missense probably damaging 1.00
R7098:Nsun7 UTSW 5 66260983 missense probably damaging 0.98
R7216:Nsun7 UTSW 5 66278657 missense probably damaging 1.00
R7276:Nsun7 UTSW 5 66277141 missense probably benign 0.03
R7803:Nsun7 UTSW 5 66276541 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGCTCTTGCACCGAGAAAG -3'
(R):5'- CAGTCAGAGCCATGGTCTAG -3'

Sequencing Primer
(F):5'- CAAAGACTGTGTCTCAAGCCGG -3'
(R):5'- CATGGTCTAGGGTGCCTGAC -3'
Posted On2016-05-10