Incidental Mutation 'R4997:Nlrp1b'
ID385366
Institutional Source Beutler Lab
Gene Symbol Nlrp1b
Ensembl Gene ENSMUSG00000070390
Gene NameNLR family, pyrin domain containing 1B
SynonymsNalp1b
MMRRC Submission 042591-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R4997 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location71153102-71230733 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71218334 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 114 (I114F)
Ref Sequence ENSEMBL: ENSMUSP00000104156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094046] [ENSMUST00000108516] [ENSMUST00000136493]
Predicted Effect probably damaging
Transcript: ENSMUST00000094046
AA Change: I114F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091588
Gene: ENSMUSG00000070390
AA Change: I114F

DomainStartEndE-ValueType
Pfam:NACHT 131 300 6.7e-43 PFAM
LRR 627 654 2.24e0 SMART
LRR 656 683 8.82e0 SMART
LRR 684 711 3.49e-5 SMART
Pfam:FIIND 812 1064 8.2e-104 PFAM
Pfam:CARD 1083 1166 3.1e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108516
AA Change: I114F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104156
Gene: ENSMUSG00000070390
AA Change: I114F

DomainStartEndE-ValueType
Pfam:NACHT 131 300 2.2e-42 PFAM
LRR 627 654 2.24e0 SMART
LRR 656 683 8.82e0 SMART
LRR 684 711 3.49e-5 SMART
Pfam:FIIND 811 1065 3.9e-136 PFAM
Pfam:CARD 1083 1166 1.1e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000136493
AA Change: I114F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121155
Gene: ENSMUSG00000070390
AA Change: I114F

DomainStartEndE-ValueType
Pfam:NACHT 131 300 8.9e-43 PFAM
PDB:4IM6|A 610 662 6e-10 PDB
Blast:LRR 627 654 3e-11 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ced-4 family of apoptosis proteins. Ced-family members contain a caspase recruitment domain (CARD) and are known to be key mediators of programmed cell death. The encoded protein contains a distinct N-terminal pyrin-like motif, which is possibly involved in protein-protein interactions. This protein interacts strongly with caspase 2 and weakly with caspase 9. Overexpression of this gene was demonstrated to induce apoptosis in cells. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit protection from anthrax lethal toxin-induced lung injury and pyroptosis of macrophages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T G 7: 28,143,924 S746A possibly damaging Het
A630023A22Rik A T 14: 34,053,666 M1L probably benign Het
Abca7 C A 10: 80,007,320 Q1210K possibly damaging Het
Abcc4 C T 14: 118,516,503 W1024* probably null Het
Accs A T 2: 93,841,883 Y213* probably null Het
Adam6a G T 12: 113,545,371 G455C probably damaging Het
Adcy1 A C 11: 7,161,298 Y863S probably benign Het
Adgrg1 A G 8: 95,009,520 D434G probably damaging Het
Afap1l1 C T 18: 61,751,808 R202Q probably benign Het
Aldh3a1 T C 11: 61,212,311 V27A probably benign Het
Antxr2 A G 5: 97,977,694 F235L probably benign Het
Arhgap23 T A 11: 97,452,020 V376E probably damaging Het
Brca1 A C 11: 101,524,333 S992A probably damaging Het
Calcrl A T 2: 84,351,248 C185* probably null Het
Cep152 T C 2: 125,586,351 T787A probably benign Het
Coch T A 12: 51,603,181 probably null Het
Col5a1 T A 2: 28,032,782 Y287* probably null Het
Dis3l A G 9: 64,311,942 S569P possibly damaging Het
Dnaic1 A G 4: 41,597,919 I74V possibly damaging Het
Dpy19l4 A G 4: 11,287,493 V394A probably benign Het
Egfem1 A G 3: 29,153,590 H122R probably benign Het
Endou A G 15: 97,719,577 L164P probably damaging Het
Epgn A G 5: 91,032,239 E80G possibly damaging Het
Fitm1 T C 14: 55,576,907 S287P probably benign Het
Foxm1 A G 6: 128,365,768 N22D probably benign Het
Gm5136 A G 10: 108,699,788 I102T probably benign Het
Gsdmc A T 15: 63,776,780 M426K probably damaging Het
Hmcn2 T A 2: 31,401,708 V2418D probably damaging Het
Hs3st2 T A 7: 121,500,456 L175Q possibly damaging Het
Il1r2 T C 1: 40,121,046 probably null Het
Il27ra A T 8: 84,039,527 Y209* probably null Het
Inpp5a A T 7: 139,400,738 S31C probably benign Het
Invs A G 4: 48,396,332 D335G probably damaging Het
Isg15 C T 4: 156,199,697 E125K possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lama4 C A 10: 39,092,266 T1468K probably damaging Het
Lce1a2 A G 3: 92,669,088 S56P unknown Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lmf1 G A 17: 25,588,676 W164* probably null Het
Mad2l1bp G T 17: 46,152,878 C73* probably null Het
Mpzl1 A C 1: 165,601,781 V230G probably damaging Het
Myo3b A G 2: 70,258,083 T869A possibly damaging Het
Ncor2 T C 5: 125,034,010 H1316R probably damaging Het
Nsun7 A G 5: 66,295,839 I632M probably benign Het
Nubp1 T C 16: 10,421,321 I234T probably benign Het
Olfml1 A G 7: 107,571,206 D100G probably damaging Het
Olfr22-ps1 T A 11: 73,954,786 L32Q probably damaging Het
Olfr498 C A 7: 108,465,494 Q57K probably benign Het
Olfr839-ps1 A T 9: 19,175,331 L115Q probably damaging Het
Osmr G T 15: 6,815,639 P882Q probably benign Het
Peg10 TCAGGATCC TCAGGATCCCCAGCAGGATCC 6: 4,756,457 probably benign Het
Per2 T A 1: 91,450,783 T15S probably benign Het
Piezo2 A G 18: 63,083,113 Y1184H probably damaging Het
Pik3c2b C T 1: 133,105,081 A1560V probably damaging Het
Pik3cd A C 4: 149,658,984 L256R probably damaging Het
Ppl C A 16: 5,089,371 R1020L probably damaging Het
Ppp1r10 A G 17: 35,924,084 N60S probably damaging Het
Prkcg T C 7: 3,322,581 probably null Het
Prkci T C 3: 31,031,226 probably null Het
Prrc2b A G 2: 32,222,311 Y1929C probably damaging Het
Prss12 T C 3: 123,447,208 V17A probably benign Het
Qtrt1 A G 9: 21,417,358 N206S probably benign Het
Rad54l2 A C 9: 106,722,909 S50A possibly damaging Het
Rhov C T 2: 119,270,468 R96H probably damaging Het
Rph3a A T 5: 120,963,843 V110E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 A T 13: 11,595,306 N646K probably benign Het
Scn8a A G 15: 100,957,054 T141A probably damaging Het
Serping1 T C 2: 84,770,285 R238G possibly damaging Het
Shank3 T A 15: 89,549,698 W1474R probably damaging Het
Slc16a12 T A 19: 34,674,958 M263L probably benign Het
Spata13 T C 14: 60,709,459 V652A probably damaging Het
Spata31 G A 13: 64,919,723 M66I probably benign Het
Spem2 T C 11: 69,817,732 I136V probably benign Het
Supt5 T C 7: 28,316,037 H925R probably benign Het
Syk A T 13: 52,612,448 K190* probably null Het
Thsd1 T A 8: 22,243,324 V129D probably damaging Het
Tiprl A G 1: 165,220,190 V174A possibly damaging Het
Tmed4 T A 11: 6,274,500 probably null Het
Tnfrsf19 T C 14: 60,971,209 T288A probably benign Het
Tnfrsf25 T C 4: 152,117,696 probably null Het
Tpd52 A G 3: 8,934,996 L121S probably damaging Het
Trim30a T A 7: 104,411,620 K316N probably benign Het
Ttc3 T G 16: 94,452,982 D1221E probably damaging Het
Ttn C T 2: 76,884,059 probably benign Het
Ttn T C 2: 76,946,271 I1514V probably benign Het
Ulk2 T C 11: 61,799,156 T671A probably benign Het
Wasf1 C T 10: 40,934,604 P281S probably damaging Het
Wnt10b C A 15: 98,774,203 R211L probably damaging Het
Xpnpep3 T A 15: 81,448,376 C371* probably null Het
Zfp41 C T 15: 75,618,768 probably benign Het
Zfp553 T A 7: 127,235,511 N79K probably benign Het
Zmynd8 G T 2: 165,792,816 D1096E probably benign Het
Other mutations in Nlrp1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Nlrp1b APN 11 71181181 intron probably benign
IGL00571:Nlrp1b APN 11 71163973 missense probably null 0.48
IGL01358:Nlrp1b APN 11 71181856 missense possibly damaging 0.91
IGL01937:Nlrp1b APN 11 71181407 missense probably damaging 0.98
IGL01945:Nlrp1b APN 11 71181407 missense probably damaging 0.98
IGL02375:Nlrp1b APN 11 71161680 missense probably damaging 1.00
IGL02552:Nlrp1b APN 11 71182052 missense possibly damaging 0.57
IGL02552:Nlrp1b APN 11 71172231 missense possibly damaging 0.96
IGL02588:Nlrp1b APN 11 71182279 nonsense probably null
IGL02833:Nlrp1b APN 11 71161172 missense probably benign
IGL02955:Nlrp1b APN 11 71169811 missense possibly damaging 0.73
IGL03002:Nlrp1b APN 11 71168859 missense probably benign 0.00
IGL03033:Nlrp1b APN 11 71161839 missense probably benign 0.22
IGL03122:Nlrp1b APN 11 71181833 missense probably benign 0.00
IGL03131:Nlrp1b APN 11 71161915 missense possibly damaging 0.82
androcles UTSW 11 71172075 nonsense probably null
Fangled UTSW 11 71172171 missense possibly damaging 0.94
glitz UTSW 11 71181550 missense possibly damaging 0.89
honeydew UTSW 11 71217884 missense possibly damaging 0.93
Mush UTSW 11 71156079 missense probably damaging 1.00
R0001:Nlrp1b UTSW 11 71161759 missense probably damaging 1.00
R0022:Nlrp1b UTSW 11 71161929 missense possibly damaging 0.61
R0022:Nlrp1b UTSW 11 71161929 missense possibly damaging 0.61
R0038:Nlrp1b UTSW 11 71172171 missense possibly damaging 0.94
R0038:Nlrp1b UTSW 11 71172171 missense possibly damaging 0.94
R0164:Nlrp1b UTSW 11 71164099 missense probably damaging 1.00
R0164:Nlrp1b UTSW 11 71164099 missense probably damaging 1.00
R0271:Nlrp1b UTSW 11 71161765 missense possibly damaging 0.51
R0464:Nlrp1b UTSW 11 71218244 missense probably damaging 1.00
R0504:Nlrp1b UTSW 11 71182415 missense probably damaging 0.99
R0605:Nlrp1b UTSW 11 71156179 missense possibly damaging 0.88
R0863:Nlrp1b UTSW 11 71181347 missense probably benign 0.00
R1075:Nlrp1b UTSW 11 71181686 missense probably benign 0.35
R1221:Nlrp1b UTSW 11 71181464 missense probably benign 0.07
R1501:Nlrp1b UTSW 11 71156059 missense probably damaging 1.00
R1654:Nlrp1b UTSW 11 71181298 missense probably damaging 0.99
R1671:Nlrp1b UTSW 11 71201259 missense probably benign 0.45
R1676:Nlrp1b UTSW 11 71182811 missense probably benign 0.13
R1694:Nlrp1b UTSW 11 71216855 critical splice donor site probably null
R1709:Nlrp1b UTSW 11 71201273 missense probably benign 0.11
R1770:Nlrp1b UTSW 11 71160153 missense probably benign 0.22
R1775:Nlrp1b UTSW 11 71161821 missense probably damaging 1.00
R1851:Nlrp1b UTSW 11 71182616 missense possibly damaging 0.96
R1932:Nlrp1b UTSW 11 71182138 missense probably damaging 0.96
R2063:Nlrp1b UTSW 11 71161086 missense probably benign 0.09
R2189:Nlrp1b UTSW 11 71169795 missense probably damaging 1.00
R2223:Nlrp1b UTSW 11 71155989 splice site probably benign
R2284:Nlrp1b UTSW 11 71156284 missense probably benign 0.00
R2434:Nlrp1b UTSW 11 71156726 splice site probably null
R3079:Nlrp1b UTSW 11 71217968 missense probably benign 0.27
R3775:Nlrp1b UTSW 11 71156300 splice site probably benign
R3980:Nlrp1b UTSW 11 71181611 missense possibly damaging 0.56
R4016:Nlrp1b UTSW 11 71173085 missense probably damaging 1.00
R4085:Nlrp1b UTSW 11 71161762 missense probably damaging 0.98
R4542:Nlrp1b UTSW 11 71228325 missense probably damaging 1.00
R4623:Nlrp1b UTSW 11 71161843 missense probably benign 0.00
R4726:Nlrp1b UTSW 11 71181406 missense probably benign 0.10
R4764:Nlrp1b UTSW 11 71182663 missense probably damaging 1.00
R4885:Nlrp1b UTSW 11 71217884 missense possibly damaging 0.93
R4910:Nlrp1b UTSW 11 71217277 missense probably benign 0.09
R5046:Nlrp1b UTSW 11 71160072 missense possibly damaging 0.95
R5126:Nlrp1b UTSW 11 71181533 missense possibly damaging 0.67
R5369:Nlrp1b UTSW 11 71181799 missense probably benign
R5388:Nlrp1b UTSW 11 71172141 missense probably damaging 1.00
R5445:Nlrp1b UTSW 11 71217875 missense probably benign 0.21
R5546:Nlrp1b UTSW 11 71217276 missense probably benign 0.04
R5567:Nlrp1b UTSW 11 71181403 missense probably benign
R5826:Nlrp1b UTSW 11 71181196 missense probably benign 0.17
R5955:Nlrp1b UTSW 11 71217865 missense probably damaging 1.00
R5995:Nlrp1b UTSW 11 71181746 missense probably damaging 1.00
R6059:Nlrp1b UTSW 11 71217010 missense possibly damaging 0.53
R6170:Nlrp1b UTSW 11 71156079 missense probably damaging 1.00
R6191:Nlrp1b UTSW 11 71218457 nonsense probably null
R6250:Nlrp1b UTSW 11 71181799 missense probably benign 0.11
R6312:Nlrp1b UTSW 11 71228397 missense probably benign 0.38
R6352:Nlrp1b UTSW 11 71181701 missense probably damaging 0.99
R6807:Nlrp1b UTSW 11 71217704 missense probably damaging 1.00
R6854:Nlrp1b UTSW 11 71228433 missense possibly damaging 0.93
R6908:Nlrp1b UTSW 11 71217296 missense probably benign
R6938:Nlrp1b UTSW 11 71218216 missense probably damaging 1.00
R7098:Nlrp1b UTSW 11 71218274 missense possibly damaging 0.89
R7142:Nlrp1b UTSW 11 71172075 nonsense probably null
R7149:Nlrp1b UTSW 11 71181656 nonsense probably null
R7349:Nlrp1b UTSW 11 71182117 missense probably benign 0.36
R7354:Nlrp1b UTSW 11 71181550 missense possibly damaging 0.89
R7750:Nlrp1b UTSW 11 71168839 missense probably benign 0.11
R7913:Nlrp1b UTSW 11 71217711 missense possibly damaging 0.93
R8031:Nlrp1b UTSW 11 71216921 missense probably benign 0.15
R8087:Nlrp1b UTSW 11 71172071 missense probably benign 0.04
R8164:Nlrp1b UTSW 11 71228417 missense possibly damaging 0.78
R8378:Nlrp1b UTSW 11 71161719 missense possibly damaging 0.95
Z1176:Nlrp1b UTSW 11 71182270 missense probably damaging 1.00
Z1177:Nlrp1b UTSW 11 71181299 nonsense probably null
Z1177:Nlrp1b UTSW 11 71217224 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTTGTGCTATGAGCTCAGCCAG -3'
(R):5'- TTCAGGGACAATTCCAAAAGTACAC -3'

Sequencing Primer
(F):5'- AGACTCAGCTGCTCATACTGG -3'
(R):5'- ACATAAAACAAAAAGGAGAGACTCTG -3'
Posted On2016-05-10