Mutagenetix > Incidental Mutations

Incidental Mutation 'R4997:Brca1'

385368

Institutional Source

Beutler Lab

Gene Symbol

Brca1

Ensembl Gene

ENSMUSG00000017146

Gene Name

breast cancer 1, early onset

Synonyms

MMRRC Submission

042591-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4997 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

101488764-101551955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 101524333 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 992 (S992A)

Ref Sequence

ENSEMBL: ENSMUSP00000017290 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017290] [ENSMUST00000142086] [ENSMUST00000191198]

Predicted Effect

probably damaging
Transcript: ENSMUST00000017290
AA Change: S992A

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000017290
Gene: ENSMUSG00000017146
AA Change: S992A

Domain	Start	End	E-Value	Type
RING	24	64	1.82e-7	SMART
Pfam:BRCT_assoc	342	503	2.6e-69	PFAM
low complexity region	1173	1185	N/A	INTRINSIC
Blast:BRCT	1343	1406	2e-16	BLAST
low complexity region	1555	1575	N/A	INTRINSIC
BRCT	1587	1669	3.87e-11	SMART
BRCT	1700	1787	3.42e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131460

Predicted Effect

probably benign
Transcript: ENSMUST00000142086

SMART Domains

Protein: ENSMUSP00000139813
Gene: ENSMUSG00000017146

Domain	Start	End	E-Value	Type
RING	24	64	8.6e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188168

Predicted Effect

possibly damaging
Transcript: ENSMUST00000191198
AA Change: S131A

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000139737
Gene: ENSMUSG00000017146
AA Change: S131A

Domain	Start	End	E-Value	Type
Pfam:EIN3	1	146	3.5e-18	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA1 protein survive, have a kinky tail, pigmentation anomalies, male infertility and increased tumor incidence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	T	G	7: 28,143,924	S746A	possibly damaging	Het
A630023A22Rik	A	T	14: 34,053,666	M1L	probably benign	Het
Abca7	C	A	10: 80,007,320	Q1210K	possibly damaging	Het
Abcc4	C	T	14: 118,516,503	W1024*	probably null	Het
Accs	A	T	2: 93,841,883	Y213*	probably null	Het
Adam6a	G	T	12: 113,545,371	G455C	probably damaging	Het
Adcy1	A	C	11: 7,161,298	Y863S	probably benign	Het
Adgrg1	A	G	8: 95,009,520	D434G	probably damaging	Het
Afap1l1	C	T	18: 61,751,808	R202Q	probably benign	Het
Aldh3a1	T	C	11: 61,212,311	V27A	probably benign	Het
Antxr2	A	G	5: 97,977,694	F235L	probably benign	Het
Arhgap23	T	A	11: 97,452,020	V376E	probably damaging	Het
Calcrl	A	T	2: 84,351,248	C185*	probably null	Het
Cep152	T	C	2: 125,586,351	T787A	probably benign	Het
Coch	T	A	12: 51,603,181		probably null	Het
Col5a1	T	A	2: 28,032,782	Y287*	probably null	Het
Dis3l	A	G	9: 64,311,942	S569P	possibly damaging	Het
Dnaic1	A	G	4: 41,597,919	I74V	possibly damaging	Het
Dpy19l4	A	G	4: 11,287,493	V394A	probably benign	Het
Egfem1	A	G	3: 29,153,590	H122R	probably benign	Het
Endou	A	G	15: 97,719,577	L164P	probably damaging	Het
Epgn	A	G	5: 91,032,239	E80G	possibly damaging	Het
Fitm1	T	C	14: 55,576,907	S287P	probably benign	Het
Foxm1	A	G	6: 128,365,768	N22D	probably benign	Het
Gm5136	A	G	10: 108,699,788	I102T	probably benign	Het
Gsdmc	A	T	15: 63,776,780	M426K	probably damaging	Het
Hmcn2	T	A	2: 31,401,708	V2418D	probably damaging	Het
Hs3st2	T	A	7: 121,500,456	L175Q	possibly damaging	Het
Il1r2	T	C	1: 40,121,046		probably null	Het
Il27ra	A	T	8: 84,039,527	Y209*	probably null	Het
Inpp5a	A	T	7: 139,400,738	S31C	probably benign	Het
Invs	A	G	4: 48,396,332	D335G	probably damaging	Het
Isg15	C	T	4: 156,199,697	E125K	possibly damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lama4	C	A	10: 39,092,266	T1468K	probably damaging	Het
Lce1a2	A	G	3: 92,669,088	S56P	unknown	Het
Llgl1	C	T	11: 60,709,568	P581L	probably benign	Het
Lmf1	G	A	17: 25,588,676	W164*	probably null	Het
Mad2l1bp	G	T	17: 46,152,878	C73*	probably null	Het
Mpzl1	A	C	1: 165,601,781	V230G	probably damaging	Het
Myo3b	A	G	2: 70,258,083	T869A	possibly damaging	Het
Ncor2	T	C	5: 125,034,010	H1316R	probably damaging	Het
Nlrp1b	T	A	11: 71,218,334	I114F	probably damaging	Het
Nsun7	A	G	5: 66,295,839	I632M	probably benign	Het
Nubp1	T	C	16: 10,421,321	I234T	probably benign	Het
Olfml1	A	G	7: 107,571,206	D100G	probably damaging	Het
Olfr22-ps1	T	A	11: 73,954,786	L32Q	probably damaging	Het
Olfr498	C	A	7: 108,465,494	Q57K	probably benign	Het
Olfr839-ps1	A	T	9: 19,175,331	L115Q	probably damaging	Het
Osmr	G	T	15: 6,815,639	P882Q	probably benign	Het
Peg10	TCAGGATCC	TCAGGATCCCCAGCAGGATCC	6: 4,756,457		probably benign	Het
Per2	T	A	1: 91,450,783	T15S	probably benign	Het
Piezo2	A	G	18: 63,083,113	Y1184H	probably damaging	Het
Pik3c2b	C	T	1: 133,105,081	A1560V	probably damaging	Het
Pik3cd	A	C	4: 149,658,984	L256R	probably damaging	Het
Ppl	C	A	16: 5,089,371	R1020L	probably damaging	Het
Ppp1r10	A	G	17: 35,924,084	N60S	probably damaging	Het
Prkcg	T	C	7: 3,322,581		probably null	Het
Prkci	T	C	3: 31,031,226		probably null	Het
Prrc2b	A	G	2: 32,222,311	Y1929C	probably damaging	Het
Prss12	T	C	3: 123,447,208	V17A	probably benign	Het
Qtrt1	A	G	9: 21,417,358	N206S	probably benign	Het
Rad54l2	A	C	9: 106,722,909	S50A	possibly damaging	Het
Rhov	C	T	2: 119,270,468	R96H	probably damaging	Het
Rph3a	A	T	5: 120,963,843	V110E	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Ryr2	A	T	13: 11,595,306	N646K	probably benign	Het
Scn8a	A	G	15: 100,957,054	T141A	probably damaging	Het
Serping1	T	C	2: 84,770,285	R238G	possibly damaging	Het
Shank3	T	A	15: 89,549,698	W1474R	probably damaging	Het
Slc16a12	T	A	19: 34,674,958	M263L	probably benign	Het
Spata13	T	C	14: 60,709,459	V652A	probably damaging	Het
Spata31	G	A	13: 64,919,723	M66I	probably benign	Het
Spem2	T	C	11: 69,817,732	I136V	probably benign	Het
Supt5	T	C	7: 28,316,037	H925R	probably benign	Het
Syk	A	T	13: 52,612,448	K190*	probably null	Het
Thsd1	T	A	8: 22,243,324	V129D	probably damaging	Het
Tiprl	A	G	1: 165,220,190	V174A	possibly damaging	Het
Tmed4	T	A	11: 6,274,500		probably null	Het
Tnfrsf19	T	C	14: 60,971,209	T288A	probably benign	Het
Tnfrsf25	T	C	4: 152,117,696		probably null	Het
Tpd52	A	G	3: 8,934,996	L121S	probably damaging	Het
Trim30a	T	A	7: 104,411,620	K316N	probably benign	Het
Ttc3	T	G	16: 94,452,982	D1221E	probably damaging	Het
Ttn	C	T	2: 76,884,059		probably benign	Het
Ttn	T	C	2: 76,946,271	I1514V	probably benign	Het
Ulk2	T	C	11: 61,799,156	T671A	probably benign	Het
Wasf1	C	T	10: 40,934,604	P281S	probably damaging	Het
Wnt10b	C	A	15: 98,774,203	R211L	probably damaging	Het
Xpnpep3	T	A	15: 81,448,376	C371*	probably null	Het
Zfp41	C	T	15: 75,618,768		probably benign	Het
Zfp553	T	A	7: 127,235,511	N79K	probably benign	Het
Zmynd8	G	T	2: 165,792,816	D1096E	probably benign	Het

Other mutations in Brca1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01095:Brca1	APN	11	101524369	missense	possibly damaging	0.71
IGL01598:Brca1	APN	11	101524330	missense	probably benign	0.04
IGL01744:Brca1	APN	11	101524176	missense	possibly damaging	0.73
IGL02128:Brca1	APN	11	101530982	unclassified	probably benign
IGL02377:Brca1	APN	11	101524323	missense	probably benign	0.01
IGL02701:Brca1	APN	11	101525235	missense	probably damaging	1.00
IGL02732:Brca1	APN	11	101492219	missense	probably benign	0.07
IGL02935:Brca1	APN	11	101489867	missense	probably benign	0.00
IGL02940:Brca1	APN	11	101489912	missense	probably benign	0.00
IGL03198:Brca1	APN	11	101512711	splice site	probably benign
PIT4142001:Brca1	UTSW	11	101522422	unclassified	probably benign
R0048:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R0048:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R0109:Brca1	UTSW	11	101531090	missense	possibly damaging	0.85
R0109:Brca1	UTSW	11	101531090	missense	possibly damaging	0.85
R0144:Brca1	UTSW	11	101526121	missense	probably damaging	1.00
R0336:Brca1	UTSW	11	101523993	missense	probably benign	0.04
R0448:Brca1	UTSW	11	101508221	missense	possibly damaging	0.93
R0595:Brca1	UTSW	11	101524887	missense	probably benign	0.27
R0613:Brca1	UTSW	11	101508210	missense	probably benign	0.18
R0863:Brca1	UTSW	11	101524770	missense	probably benign	0.36
R0940:Brca1	UTSW	11	101532143	missense	possibly damaging	0.73
R0962:Brca1	UTSW	11	101525366	missense	possibly damaging	0.46
R1365:Brca1	UTSW	11	101501996	missense	probably benign
R1391:Brca1	UTSW	11	101526546	missense	possibly damaging	0.53
R1467:Brca1	UTSW	11	101531107	unclassified	probably benign
R1484:Brca1	UTSW	11	101529812	missense	possibly damaging	0.86
R1530:Brca1	UTSW	11	101524695	missense	probably damaging	1.00
R1645:Brca1	UTSW	11	101510053	missense	probably benign	0.00
R1682:Brca1	UTSW	11	101525565	missense	probably damaging	0.98
R1687:Brca1	UTSW	11	101489840	missense	probably benign
R1694:Brca1	UTSW	11	101532099	missense	probably damaging	0.98
R1695:Brca1	UTSW	11	101524455	missense	probably damaging	0.97
R1762:Brca1	UTSW	11	101532018	critical splice donor site	probably null
R1868:Brca1	UTSW	11	101498013	missense	probably benign
R1973:Brca1	UTSW	11	101526403	missense	probably benign	0.22
R2034:Brca1	UTSW	11	101489849	missense	probably benign
R2106:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R4089:Brca1	UTSW	11	101524176	missense	possibly damaging	0.73
R4194:Brca1	UTSW	11	101525287	missense	probably benign	0.02
R4571:Brca1	UTSW	11	101517366	missense	probably benign	0.00
R4735:Brca1	UTSW	11	101492175	splice site	probably null
R4789:Brca1	UTSW	11	101523932	missense	probably benign	0.00
R4920:Brca1	UTSW	11	101524959	missense	probably damaging	1.00
R4939:Brca1	UTSW	11	101508050	missense	probably benign
R5458:Brca1	UTSW	11	101517285	missense	possibly damaging	0.53
R5778:Brca1	UTSW	11	101525301	missense	possibly damaging	0.47
R6051:Brca1	UTSW	11	101524246	missense	probably damaging	1.00
R6505:Brca1	UTSW	11	101523541	missense	probably benign	0.03
R6548:Brca1	UTSW	11	101524765	missense	probably damaging	1.00
R6971:Brca1	UTSW	11	101534005	missense	probably benign	0.18
R7091:Brca1	UTSW	11	101526427	missense	probably benign	0.00
R7246:Brca1	UTSW	11	101523378	missense	probably benign	0.00
R7417:Brca1	UTSW	11	101524981	missense	probably damaging	1.00
R7861:Brca1	UTSW	11	101526422	missense	possibly damaging	0.87
R7944:Brca1	UTSW	11	101526422	missense	possibly damaging	0.87
R8003:Brca1	UTSW	11	101524477	missense	probably benign	0.22
R8046:Brca1	UTSW	11	101525470	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- ACAGTGTTCACCTTAGGCCC -3'
(R):5'- TCAAGAAGGTAAGCTAGCTGC -3'

Sequencing Primer
(F):5'- AGGCCCTCTGTTTCTACCTAG -3'
(R):5'- GCTAGCTGCTGATACAATGTG -3'

Posted On

2016-05-10