Incidental Mutation 'R4997:Spata13'
Institutional Source Beutler Lab
Gene Symbol Spata13
Ensembl Gene ENSMUSG00000021990
Gene Namespermatogenesis associated 13
MMRRC Submission 042591-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4997 (G1)
Quality Score225
Status Not validated
Chromosomal Location60634001-60764556 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60709459 bp
Amino Acid Change Valine to Alanine at position 652 (V652A)
Ref Sequence ENSEMBL: ENSMUSP00000123928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022566] [ENSMUST00000160973]
Predicted Effect probably damaging
Transcript: ENSMUST00000022566
AA Change: V652A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022566
Gene: ENSMUSG00000021990
AA Change: V652A

low complexity region 307 320 N/A INTRINSIC
low complexity region 354 370 N/A INTRINSIC
low complexity region 426 450 N/A INTRINSIC
low complexity region 453 462 N/A INTRINSIC
low complexity region 540 557 N/A INTRINSIC
low complexity region 571 584 N/A INTRINSIC
low complexity region 604 623 N/A INTRINSIC
SH3 742 797 4.92e-16 SMART
RhoGEF 836 1015 1.22e-58 SMART
PH 1048 1155 1.16e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159476
Predicted Effect unknown
Transcript: ENSMUST00000160095
AA Change: V203A
SMART Domains Protein: ENSMUSP00000123744
Gene: ENSMUSG00000021990
AA Change: V203A

low complexity region 28 44 N/A INTRINSIC
low complexity region 100 124 N/A INTRINSIC
low complexity region 127 136 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160973
AA Change: V652A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123928
Gene: ENSMUSG00000021990
AA Change: V652A

low complexity region 307 320 N/A INTRINSIC
low complexity region 354 370 N/A INTRINSIC
low complexity region 426 450 N/A INTRINSIC
low complexity region 453 462 N/A INTRINSIC
low complexity region 540 557 N/A INTRINSIC
low complexity region 571 584 N/A INTRINSIC
low complexity region 604 623 N/A INTRINSIC
SH3 742 797 4.92e-16 SMART
RhoGEF 836 1015 1.22e-58 SMART
PH 1048 1155 1.16e-9 SMART
Predicted Effect unknown
Transcript: ENSMUST00000162131
AA Change: V117A
SMART Domains Protein: ENSMUSP00000124586
Gene: ENSMUSG00000021990
AA Change: V117A

low complexity region 16 33 N/A INTRINSIC
low complexity region 47 60 N/A INTRINSIC
low complexity region 80 99 N/A INTRINSIC
SH3 208 263 4.92e-16 SMART
Blast:RhoGEF 302 340 7e-19 BLAST
Meta Mutation Damage Score 0.2238 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and overtly normal but show a significant reduction in the number and size of intestinal adenomas in conjunction with ApcMin heterozygotes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T G 7: 28,143,924 S746A possibly damaging Het
A630023A22Rik A T 14: 34,053,666 M1L probably benign Het
Abca7 C A 10: 80,007,320 Q1210K possibly damaging Het
Abcc4 C T 14: 118,516,503 W1024* probably null Het
Accs A T 2: 93,841,883 Y213* probably null Het
Adam6a G T 12: 113,545,371 G455C probably damaging Het
Adcy1 A C 11: 7,161,298 Y863S probably benign Het
Adgrg1 A G 8: 95,009,520 D434G probably damaging Het
Afap1l1 C T 18: 61,751,808 R202Q probably benign Het
Aldh3a1 T C 11: 61,212,311 V27A probably benign Het
Antxr2 A G 5: 97,977,694 F235L probably benign Het
Arhgap23 T A 11: 97,452,020 V376E probably damaging Het
Brca1 A C 11: 101,524,333 S992A probably damaging Het
Calcrl A T 2: 84,351,248 C185* probably null Het
Cep152 T C 2: 125,586,351 T787A probably benign Het
Coch T A 12: 51,603,181 probably null Het
Col5a1 T A 2: 28,032,782 Y287* probably null Het
Dis3l A G 9: 64,311,942 S569P possibly damaging Het
Dnaic1 A G 4: 41,597,919 I74V possibly damaging Het
Dpy19l4 A G 4: 11,287,493 V394A probably benign Het
Egfem1 A G 3: 29,153,590 H122R probably benign Het
Endou A G 15: 97,719,577 L164P probably damaging Het
Epgn A G 5: 91,032,239 E80G possibly damaging Het
Fitm1 T C 14: 55,576,907 S287P probably benign Het
Foxm1 A G 6: 128,365,768 N22D probably benign Het
Gm5136 A G 10: 108,699,788 I102T probably benign Het
Gsdmc A T 15: 63,776,780 M426K probably damaging Het
Hmcn2 T A 2: 31,401,708 V2418D probably damaging Het
Hs3st2 T A 7: 121,500,456 L175Q possibly damaging Het
Il1r2 T C 1: 40,121,046 probably null Het
Il27ra A T 8: 84,039,527 Y209* probably null Het
Inpp5a A T 7: 139,400,738 S31C probably benign Het
Invs A G 4: 48,396,332 D335G probably damaging Het
Isg15 C T 4: 156,199,697 E125K possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lama4 C A 10: 39,092,266 T1468K probably damaging Het
Lce1a2 A G 3: 92,669,088 S56P unknown Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lmf1 G A 17: 25,588,676 W164* probably null Het
Mad2l1bp G T 17: 46,152,878 C73* probably null Het
Mpzl1 A C 1: 165,601,781 V230G probably damaging Het
Myo3b A G 2: 70,258,083 T869A possibly damaging Het
Ncor2 T C 5: 125,034,010 H1316R probably damaging Het
Nlrp1b T A 11: 71,218,334 I114F probably damaging Het
Nsun7 A G 5: 66,295,839 I632M probably benign Het
Nubp1 T C 16: 10,421,321 I234T probably benign Het
Olfml1 A G 7: 107,571,206 D100G probably damaging Het
Olfr22-ps1 T A 11: 73,954,786 L32Q probably damaging Het
Olfr498 C A 7: 108,465,494 Q57K probably benign Het
Olfr839-ps1 A T 9: 19,175,331 L115Q probably damaging Het
Osmr G T 15: 6,815,639 P882Q probably benign Het
Peg10 TCAGGATCC TCAGGATCCCCAGCAGGATCC 6: 4,756,457 probably benign Het
Per2 T A 1: 91,450,783 T15S probably benign Het
Piezo2 A G 18: 63,083,113 Y1184H probably damaging Het
Pik3c2b C T 1: 133,105,081 A1560V probably damaging Het
Pik3cd A C 4: 149,658,984 L256R probably damaging Het
Ppl C A 16: 5,089,371 R1020L probably damaging Het
Ppp1r10 A G 17: 35,924,084 N60S probably damaging Het
Prkcg T C 7: 3,322,581 probably null Het
Prkci T C 3: 31,031,226 probably null Het
Prrc2b A G 2: 32,222,311 Y1929C probably damaging Het
Prss12 T C 3: 123,447,208 V17A probably benign Het
Qtrt1 A G 9: 21,417,358 N206S probably benign Het
Rad54l2 A C 9: 106,722,909 S50A possibly damaging Het
Rhov C T 2: 119,270,468 R96H probably damaging Het
Rph3a A T 5: 120,963,843 V110E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 A T 13: 11,595,306 N646K probably benign Het
Scn8a A G 15: 100,957,054 T141A probably damaging Het
Serping1 T C 2: 84,770,285 R238G possibly damaging Het
Shank3 T A 15: 89,549,698 W1474R probably damaging Het
Slc16a12 T A 19: 34,674,958 M263L probably benign Het
Spata31 G A 13: 64,919,723 M66I probably benign Het
Spem2 T C 11: 69,817,732 I136V probably benign Het
Supt5 T C 7: 28,316,037 H925R probably benign Het
Syk A T 13: 52,612,448 K190* probably null Het
Thsd1 T A 8: 22,243,324 V129D probably damaging Het
Tiprl A G 1: 165,220,190 V174A possibly damaging Het
Tmed4 T A 11: 6,274,500 probably null Het
Tnfrsf19 T C 14: 60,971,209 T288A probably benign Het
Tnfrsf25 T C 4: 152,117,696 probably null Het
Tpd52 A G 3: 8,934,996 L121S probably damaging Het
Trim30a T A 7: 104,411,620 K316N probably benign Het
Ttc3 T G 16: 94,452,982 D1221E probably damaging Het
Ttn C T 2: 76,884,059 probably benign Het
Ttn T C 2: 76,946,271 I1514V probably benign Het
Ulk2 T C 11: 61,799,156 T671A probably benign Het
Wasf1 C T 10: 40,934,604 P281S probably damaging Het
Wnt10b C A 15: 98,774,203 R211L probably damaging Het
Xpnpep3 T A 15: 81,448,376 C371* probably null Het
Zfp41 C T 15: 75,618,768 probably benign Het
Zfp553 T A 7: 127,235,511 N79K probably benign Het
Zmynd8 G T 2: 165,792,816 D1096E probably benign Het
Other mutations in Spata13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02364:Spata13 APN 14 60691274 missense probably damaging 1.00
IGL02455:Spata13 APN 14 60706714 missense probably benign 0.01
IGL03189:Spata13 APN 14 60691614 missense possibly damaging 0.71
IGL03235:Spata13 APN 14 60751792 missense probably damaging 1.00
PIT4378001:Spata13 UTSW 14 60749996 missense probably damaging 1.00
R0278:Spata13 UTSW 14 60692088 missense probably benign 0.02
R0316:Spata13 UTSW 14 60692339 missense probably benign
R0458:Spata13 UTSW 14 60692043 missense probably damaging 0.98
R1546:Spata13 UTSW 14 60756408 missense probably damaging 1.00
R1780:Spata13 UTSW 14 60691725 missense probably damaging 0.96
R1791:Spata13 UTSW 14 60709459 missense probably damaging 1.00
R1970:Spata13 UTSW 14 60691463 missense probably damaging 0.99
R2059:Spata13 UTSW 14 60759591 missense possibly damaging 0.79
R2063:Spata13 UTSW 14 60760871 critical splice acceptor site probably benign
R2068:Spata13 UTSW 14 60760871 critical splice acceptor site probably benign
R2212:Spata13 UTSW 14 60706723 missense probably benign 0.00
R2327:Spata13 UTSW 14 60709555 missense probably damaging 0.98
R3414:Spata13 UTSW 14 60706723 missense probably benign 0.00
R4115:Spata13 UTSW 14 60692478 missense probably damaging 1.00
R4276:Spata13 UTSW 14 60756296 missense probably damaging 1.00
R4289:Spata13 UTSW 14 60691074 missense probably damaging 1.00
R4291:Spata13 UTSW 14 60709555 missense probably damaging 0.98
R4293:Spata13 UTSW 14 60709555 missense probably damaging 0.98
R4294:Spata13 UTSW 14 60709555 missense probably damaging 0.98
R4295:Spata13 UTSW 14 60709555 missense probably damaging 0.98
R4779:Spata13 UTSW 14 60753907 nonsense probably null
R4780:Spata13 UTSW 14 60753907 nonsense probably null
R4838:Spata13 UTSW 14 60733179 missense probably benign 0.17
R5066:Spata13 UTSW 14 60750089 missense possibly damaging 0.78
R5399:Spata13 UTSW 14 60747541 missense probably benign 0.00
R5685:Spata13 UTSW 14 60691203 missense probably benign 0.00
R5708:Spata13 UTSW 14 60692003 missense probably damaging 1.00
R5747:Spata13 UTSW 14 60747503 missense probably benign 0.00
R6073:Spata13 UTSW 14 60750021 missense probably damaging 1.00
R6135:Spata13 UTSW 14 60756428 missense probably damaging 0.98
R6233:Spata13 UTSW 14 60692007 missense probably benign 0.06
R6782:Spata13 UTSW 14 60691463 missense probably damaging 0.99
R6873:Spata13 UTSW 14 60691957 missense probably benign
R6958:Spata13 UTSW 14 60751851 missense possibly damaging 0.94
R7105:Spata13 UTSW 14 60753870 missense probably damaging 0.97
R7286:Spata13 UTSW 14 60756422 missense probably damaging 1.00
R7512:Spata13 UTSW 14 60751777 missense probably damaging 1.00
R7565:Spata13 UTSW 14 60751849 missense probably damaging 1.00
R7608:Spata13 UTSW 14 60692507 missense possibly damaging 0.50
R7743:Spata13 UTSW 14 60756249 missense probably damaging 0.99
R7795:Spata13 UTSW 14 60691842 missense possibly damaging 0.92
R7959:Spata13 UTSW 14 60756230 nonsense probably null
R8073:Spata13 UTSW 14 60691256 missense probably damaging 1.00
R8304:Spata13 UTSW 14 60756508 missense possibly damaging 0.77
R8791:Spata13 UTSW 14 60691826 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2016-05-10