Incidental Mutation 'R4997:Piezo2'
Institutional Source Beutler Lab
Gene Symbol Piezo2
Ensembl Gene ENSMUSG00000041482
Gene Namepiezo-type mechanosensitive ion channel component 2
SynonymsFam38b, Fam38b2, 9030411M15Rik, Piezo2, 9430028L06Rik
MMRRC Submission 042591-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4997 (G1)
Quality Score225
Status Not validated
Chromosomal Location63010213-63387183 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63083113 bp
Amino Acid Change Tyrosine to Histidine at position 1184 (Y1184H)
Ref Sequence ENSEMBL: ENSMUSP00000138758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047480] [ENSMUST00000182233] [ENSMUST00000183217]
Predicted Effect probably damaging
Transcript: ENSMUST00000047480
AA Change: Y1198H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482
AA Change: Y1198H

transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
SCOP:d1eq1a_ 597 666 4e-3 SMART
transmembrane domain 682 704 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
internal_repeat_1 740 764 6.01e-5 PROSPERO
low complexity region 772 784 N/A INTRINSIC
transmembrane domain 791 813 N/A INTRINSIC
low complexity region 900 921 N/A INTRINSIC
transmembrane domain 949 971 N/A INTRINSIC
transmembrane domain 976 993 N/A INTRINSIC
transmembrane domain 1000 1022 N/A INTRINSIC
transmembrane domain 1069 1091 N/A INTRINSIC
transmembrane domain 1130 1152 N/A INTRINSIC
transmembrane domain 1156 1173 N/A INTRINSIC
transmembrane domain 1186 1208 N/A INTRINSIC
transmembrane domain 1234 1256 N/A INTRINSIC
transmembrane domain 1308 1327 N/A INTRINSIC
transmembrane domain 1331 1353 N/A INTRINSIC
Pfam:PIEZO 1383 1617 1.1e-105 PFAM
low complexity region 1807 1823 N/A INTRINSIC
low complexity region 1836 1860 N/A INTRINSIC
low complexity region 1863 1878 N/A INTRINSIC
transmembrane domain 1981 2003 N/A INTRINSIC
transmembrane domain 2010 2027 N/A INTRINSIC
internal_repeat_1 2036 2060 6.01e-5 PROSPERO
low complexity region 2167 2199 N/A INTRINSIC
transmembrane domain 2261 2283 N/A INTRINSIC
transmembrane domain 2303 2325 N/A INTRINSIC
transmembrane domain 2332 2354 N/A INTRINSIC
transmembrane domain 2364 2386 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2412 2821 2.8e-161 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000182233
AA Change: Y966H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138170
Gene: ENSMUSG00000041482
AA Change: Y966H

transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 34 56 N/A INTRINSIC
coiled coil region 223 250 N/A INTRINSIC
transmembrane domain 272 294 N/A INTRINSIC
transmembrane domain 307 329 N/A INTRINSIC
SCOP:d1eq1a_ 365 434 1e-3 SMART
transmembrane domain 450 472 N/A INTRINSIC
transmembrane domain 476 498 N/A INTRINSIC
transmembrane domain 505 527 N/A INTRINSIC
low complexity region 540 552 N/A INTRINSIC
transmembrane domain 559 581 N/A INTRINSIC
low complexity region 668 689 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 744 761 N/A INTRINSIC
transmembrane domain 768 790 N/A INTRINSIC
transmembrane domain 837 859 N/A INTRINSIC
transmembrane domain 898 920 N/A INTRINSIC
transmembrane domain 924 941 N/A INTRINSIC
transmembrane domain 954 976 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183217
AA Change: Y1184H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138758
Gene: ENSMUSG00000041482
AA Change: Y1184H

transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
SCOP:d1eq1a_ 597 666 4e-3 SMART
transmembrane domain 682 704 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
transmembrane domain 737 759 N/A INTRINSIC
low complexity region 772 784 N/A INTRINSIC
transmembrane domain 791 813 N/A INTRINSIC
low complexity region 886 907 N/A INTRINSIC
transmembrane domain 935 957 N/A INTRINSIC
transmembrane domain 962 979 N/A INTRINSIC
transmembrane domain 986 1008 N/A INTRINSIC
transmembrane domain 1055 1077 N/A INTRINSIC
transmembrane domain 1116 1138 N/A INTRINSIC
transmembrane domain 1142 1159 N/A INTRINSIC
transmembrane domain 1172 1194 N/A INTRINSIC
transmembrane domain 1220 1242 N/A INTRINSIC
transmembrane domain 1294 1313 N/A INTRINSIC
transmembrane domain 1317 1339 N/A INTRINSIC
transmembrane domain 1352 1374 N/A INTRINSIC
coiled coil region 1460 1501 N/A INTRINSIC
low complexity region 1528 1537 N/A INTRINSIC
low complexity region 1558 1575 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T G 7: 28,143,924 S746A possibly damaging Het
A630023A22Rik A T 14: 34,053,666 M1L probably benign Het
Abca7 C A 10: 80,007,320 Q1210K possibly damaging Het
Abcc4 C T 14: 118,516,503 W1024* probably null Het
Accs A T 2: 93,841,883 Y213* probably null Het
Adam6a G T 12: 113,545,371 G455C probably damaging Het
Adcy1 A C 11: 7,161,298 Y863S probably benign Het
Adgrg1 A G 8: 95,009,520 D434G probably damaging Het
Afap1l1 C T 18: 61,751,808 R202Q probably benign Het
Aldh3a1 T C 11: 61,212,311 V27A probably benign Het
Antxr2 A G 5: 97,977,694 F235L probably benign Het
Arhgap23 T A 11: 97,452,020 V376E probably damaging Het
Brca1 A C 11: 101,524,333 S992A probably damaging Het
Calcrl A T 2: 84,351,248 C185* probably null Het
Cep152 T C 2: 125,586,351 T787A probably benign Het
Coch T A 12: 51,603,181 probably null Het
Col5a1 T A 2: 28,032,782 Y287* probably null Het
Dis3l A G 9: 64,311,942 S569P possibly damaging Het
Dnaic1 A G 4: 41,597,919 I74V possibly damaging Het
Dpy19l4 A G 4: 11,287,493 V394A probably benign Het
Egfem1 A G 3: 29,153,590 H122R probably benign Het
Endou A G 15: 97,719,577 L164P probably damaging Het
Epgn A G 5: 91,032,239 E80G possibly damaging Het
Fitm1 T C 14: 55,576,907 S287P probably benign Het
Foxm1 A G 6: 128,365,768 N22D probably benign Het
Gm5136 A G 10: 108,699,788 I102T probably benign Het
Gsdmc A T 15: 63,776,780 M426K probably damaging Het
Hmcn2 T A 2: 31,401,708 V2418D probably damaging Het
Hs3st2 T A 7: 121,500,456 L175Q possibly damaging Het
Il1r2 T C 1: 40,121,046 probably null Het
Il27ra A T 8: 84,039,527 Y209* probably null Het
Inpp5a A T 7: 139,400,738 S31C probably benign Het
Invs A G 4: 48,396,332 D335G probably damaging Het
Isg15 C T 4: 156,199,697 E125K possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lama4 C A 10: 39,092,266 T1468K probably damaging Het
Lce1a2 A G 3: 92,669,088 S56P unknown Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lmf1 G A 17: 25,588,676 W164* probably null Het
Mad2l1bp G T 17: 46,152,878 C73* probably null Het
Mpzl1 A C 1: 165,601,781 V230G probably damaging Het
Myo3b A G 2: 70,258,083 T869A possibly damaging Het
Ncor2 T C 5: 125,034,010 H1316R probably damaging Het
Nlrp1b T A 11: 71,218,334 I114F probably damaging Het
Nsun7 A G 5: 66,295,839 I632M probably benign Het
Nubp1 T C 16: 10,421,321 I234T probably benign Het
Olfml1 A G 7: 107,571,206 D100G probably damaging Het
Olfr22-ps1 T A 11: 73,954,786 L32Q probably damaging Het
Olfr498 C A 7: 108,465,494 Q57K probably benign Het
Olfr839-ps1 A T 9: 19,175,331 L115Q probably damaging Het
Osmr G T 15: 6,815,639 P882Q probably benign Het
Peg10 TCAGGATCC TCAGGATCCCCAGCAGGATCC 6: 4,756,457 probably benign Het
Per2 T A 1: 91,450,783 T15S probably benign Het
Pik3c2b C T 1: 133,105,081 A1560V probably damaging Het
Pik3cd A C 4: 149,658,984 L256R probably damaging Het
Ppl C A 16: 5,089,371 R1020L probably damaging Het
Ppp1r10 A G 17: 35,924,084 N60S probably damaging Het
Prkcg T C 7: 3,322,581 probably null Het
Prkci T C 3: 31,031,226 probably null Het
Prrc2b A G 2: 32,222,311 Y1929C probably damaging Het
Prss12 T C 3: 123,447,208 V17A probably benign Het
Qtrt1 A G 9: 21,417,358 N206S probably benign Het
Rad54l2 A C 9: 106,722,909 S50A possibly damaging Het
Rhov C T 2: 119,270,468 R96H probably damaging Het
Rph3a A T 5: 120,963,843 V110E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 A T 13: 11,595,306 N646K probably benign Het
Scn8a A G 15: 100,957,054 T141A probably damaging Het
Serping1 T C 2: 84,770,285 R238G possibly damaging Het
Shank3 T A 15: 89,549,698 W1474R probably damaging Het
Slc16a12 T A 19: 34,674,958 M263L probably benign Het
Spata13 T C 14: 60,709,459 V652A probably damaging Het
Spata31 G A 13: 64,919,723 M66I probably benign Het
Spem2 T C 11: 69,817,732 I136V probably benign Het
Supt5 T C 7: 28,316,037 H925R probably benign Het
Syk A T 13: 52,612,448 K190* probably null Het
Thsd1 T A 8: 22,243,324 V129D probably damaging Het
Tiprl A G 1: 165,220,190 V174A possibly damaging Het
Tmed4 T A 11: 6,274,500 probably null Het
Tnfrsf19 T C 14: 60,971,209 T288A probably benign Het
Tnfrsf25 T C 4: 152,117,696 probably null Het
Tpd52 A G 3: 8,934,996 L121S probably damaging Het
Trim30a T A 7: 104,411,620 K316N probably benign Het
Ttc3 T G 16: 94,452,982 D1221E probably damaging Het
Ttn C T 2: 76,884,059 probably benign Het
Ttn T C 2: 76,946,271 I1514V probably benign Het
Ulk2 T C 11: 61,799,156 T671A probably benign Het
Wasf1 C T 10: 40,934,604 P281S probably damaging Het
Wnt10b C A 15: 98,774,203 R211L probably damaging Het
Xpnpep3 T A 15: 81,448,376 C371* probably null Het
Zfp41 C T 15: 75,618,768 probably benign Het
Zfp553 T A 7: 127,235,511 N79K probably benign Het
Zmynd8 G T 2: 165,792,816 D1096E probably benign Het
Other mutations in Piezo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Piezo2 APN 18 63117699 missense probably damaging 1.00
IGL01370:Piezo2 APN 18 63022460 missense probably damaging 1.00
IGL01543:Piezo2 APN 18 63070030 missense probably damaging 1.00
IGL01561:Piezo2 APN 18 63124614 missense probably benign 0.03
IGL01568:Piezo2 APN 18 63030392 missense probably benign 0.28
IGL01653:Piezo2 APN 18 63182833 splice site probably benign
IGL01674:Piezo2 APN 18 63027559 missense probably damaging 1.00
IGL01684:Piezo2 APN 18 63083170 missense probably damaging 1.00
IGL01744:Piezo2 APN 18 63042788 missense probably damaging 1.00
IGL01859:Piezo2 APN 18 63092844 missense probably benign 0.10
IGL02183:Piezo2 APN 18 63020634 missense probably benign 0.00
IGL02407:Piezo2 APN 18 63146844 missense probably damaging 1.00
IGL02441:Piezo2 APN 18 63072862 missense probably damaging 1.00
IGL02542:Piezo2 APN 18 63032924 missense probably damaging 0.96
IGL02652:Piezo2 APN 18 63024475 missense probably damaging 1.00
IGL02710:Piezo2 APN 18 63074659 missense probably damaging 1.00
IGL02850:Piezo2 APN 18 63020633 missense probably benign 0.18
IGL02851:Piezo2 APN 18 63020633 missense probably benign 0.18
IGL02972:Piezo2 APN 18 63064785 splice site probably benign
IGL03011:Piezo2 APN 18 63124660 missense probably benign 0.03
IGL03078:Piezo2 APN 18 63070075 missense probably damaging 1.00
IGL03114:Piezo2 APN 18 63030272 splice site probably null
IGL03129:Piezo2 APN 18 63114972 missense probably benign
IGL03143:Piezo2 APN 18 63108076 missense probably damaging 0.99
IGL03202:Piezo2 APN 18 63011598 missense probably damaging 1.00
IGL03227:Piezo2 APN 18 63124606 missense probably damaging 1.00
IGL03228:Piezo2 APN 18 63053062 missense probably damaging 1.00
IGL03230:Piezo2 APN 18 63041720 missense probably damaging 1.00
IGL03242:Piezo2 APN 18 63011538 utr 3 prime probably benign
IGL03291:Piezo2 APN 18 63021308 missense probably damaging 1.00
IGL03301:Piezo2 APN 18 63027704 missense probably damaging 1.00
Piccolo UTSW 18 63011696 missense probably damaging 1.00
P0023:Piezo2 UTSW 18 63386200 splice site probably benign
PIT4802001:Piezo2 UTSW 18 63024469 missense probably damaging 1.00
R0070:Piezo2 UTSW 18 63102084 missense probably damaging 1.00
R0416:Piezo2 UTSW 18 63024491 missense probably damaging 1.00
R0486:Piezo2 UTSW 18 63029061 missense probably damaging 1.00
R0498:Piezo2 UTSW 18 63102174 missense possibly damaging 0.87
R0504:Piezo2 UTSW 18 63024451 missense probably damaging 1.00
R0506:Piezo2 UTSW 18 63027544 missense probably damaging 1.00
R0523:Piezo2 UTSW 18 63022481 missense probably damaging 1.00
R0587:Piezo2 UTSW 18 63022426 missense possibly damaging 0.82
R0626:Piezo2 UTSW 18 63019258 missense probably damaging 0.97
R0734:Piezo2 UTSW 18 63041723 missense probably damaging 1.00
R0784:Piezo2 UTSW 18 63083235 missense probably damaging 1.00
R0973:Piezo2 UTSW 18 63015802 missense probably damaging 1.00
R1183:Piezo2 UTSW 18 63086753 missense probably damaging 1.00
R1344:Piezo2 UTSW 18 63021254 missense probably damaging 1.00
R1474:Piezo2 UTSW 18 63083131 missense probably damaging 1.00
R1571:Piezo2 UTSW 18 63144919 missense possibly damaging 0.67
R1643:Piezo2 UTSW 18 63082915 missense probably benign 0.03
R1649:Piezo2 UTSW 18 63117672 missense probably benign 0.34
R1741:Piezo2 UTSW 18 63021173 missense probably damaging 1.00
R1764:Piezo2 UTSW 18 63124642 missense possibly damaging 0.50
R1793:Piezo2 UTSW 18 63106284 missense possibly damaging 0.78
R1799:Piezo2 UTSW 18 63032840 critical splice donor site probably null
R1799:Piezo2 UTSW 18 63108087 missense probably damaging 1.00
R1868:Piezo2 UTSW 18 63019344 missense probably damaging 1.00
R1879:Piezo2 UTSW 18 63113960 missense probably damaging 1.00
R1962:Piezo2 UTSW 18 63078840 missense probably damaging 0.98
R1990:Piezo2 UTSW 18 63074662 missense probably null 1.00
R1991:Piezo2 UTSW 18 63074662 missense probably null 1.00
R1992:Piezo2 UTSW 18 63074662 missense probably null 1.00
R1995:Piezo2 UTSW 18 63078781 missense probably damaging 1.00
R2004:Piezo2 UTSW 18 63144926 missense probably damaging 1.00
R2011:Piezo2 UTSW 18 63059744 missense probably damaging 1.00
R2029:Piezo2 UTSW 18 63118935 missense possibly damaging 0.62
R2075:Piezo2 UTSW 18 63081734 missense probably damaging 1.00
R2078:Piezo2 UTSW 18 63117720 missense probably damaging 0.99
R2152:Piezo2 UTSW 18 63114041 missense probably damaging 1.00
R2162:Piezo2 UTSW 18 63081662 critical splice donor site probably null
R2183:Piezo2 UTSW 18 63106274 missense probably damaging 1.00
R2230:Piezo2 UTSW 18 63145072 missense probably damaging 1.00
R2231:Piezo2 UTSW 18 63145072 missense probably damaging 1.00
R2406:Piezo2 UTSW 18 63022525 missense probably damaging 1.00
R2431:Piezo2 UTSW 18 63245624 missense possibly damaging 0.95
R2876:Piezo2 UTSW 18 63053035 missense probably damaging 1.00
R2935:Piezo2 UTSW 18 63146843 missense probably damaging 1.00
R3004:Piezo2 UTSW 18 63024435 nonsense probably null
R3016:Piezo2 UTSW 18 63042832 missense probably damaging 1.00
R3794:Piezo2 UTSW 18 63081793 missense probably damaging 0.99
R3832:Piezo2 UTSW 18 63081662 critical splice donor site probably null
R3833:Piezo2 UTSW 18 63081662 critical splice donor site probably null
R3968:Piezo2 UTSW 18 63011696 missense probably damaging 1.00
R3969:Piezo2 UTSW 18 63011696 missense probably damaging 1.00
R3970:Piezo2 UTSW 18 63011696 missense probably damaging 1.00
R4169:Piezo2 UTSW 18 63050604 missense probably benign
R4181:Piezo2 UTSW 18 63124730 critical splice acceptor site probably null
R4301:Piezo2 UTSW 18 63084840 missense probably damaging 1.00
R4302:Piezo2 UTSW 18 63124730 critical splice acceptor site probably null
R4475:Piezo2 UTSW 18 63102099 missense probably damaging 1.00
R4493:Piezo2 UTSW 18 63114063 missense probably damaging 0.98
R4519:Piezo2 UTSW 18 63072880 missense probably damaging 1.00
R4539:Piezo2 UTSW 18 63086628 missense probably damaging 1.00
R4687:Piezo2 UTSW 18 63069963 missense probably damaging 1.00
R4732:Piezo2 UTSW 18 63030401 missense probably damaging 1.00
R4733:Piezo2 UTSW 18 63030401 missense probably damaging 1.00
R4825:Piezo2 UTSW 18 63144954 missense probably damaging 0.98
R4899:Piezo2 UTSW 18 63078791 missense possibly damaging 0.84
R4946:Piezo2 UTSW 18 63157262 missense probably benign
R4961:Piezo2 UTSW 18 63052961 splice site probably null
R4968:Piezo2 UTSW 18 63144971 nonsense probably null
R4973:Piezo2 UTSW 18 63074680 missense probably damaging 1.00
R5078:Piezo2 UTSW 18 63024536 missense probably damaging 1.00
R5134:Piezo2 UTSW 18 63074620 missense probably damaging 1.00
R5151:Piezo2 UTSW 18 63030409 missense possibly damaging 0.72
R5209:Piezo2 UTSW 18 63032929 missense probably damaging 1.00
R5367:Piezo2 UTSW 18 63064731 missense probably damaging 1.00
R5401:Piezo2 UTSW 18 63084740 missense possibly damaging 0.81
R5464:Piezo2 UTSW 18 63145105 missense probably damaging 1.00
R5469:Piezo2 UTSW 18 63027864 missense probably damaging 1.00
R5650:Piezo2 UTSW 18 63011721 missense probably damaging 1.00
R5654:Piezo2 UTSW 18 63145091 missense possibly damaging 0.94
R5677:Piezo2 UTSW 18 63117696 missense possibly damaging 0.94
R5677:Piezo2 UTSW 18 63117697 missense probably benign 0.25
R5792:Piezo2 UTSW 18 63146856 missense probably damaging 1.00
R5874:Piezo2 UTSW 18 63027901 missense probably damaging 1.00
R5877:Piezo2 UTSW 18 63113934 missense probably benign 0.22
R6036:Piezo2 UTSW 18 63114948 nonsense probably null
R6036:Piezo2 UTSW 18 63114948 nonsense probably null
R6073:Piezo2 UTSW 18 63012645 missense probably damaging 1.00
R6198:Piezo2 UTSW 18 63157210 nonsense probably null
R6255:Piezo2 UTSW 18 63121270 missense possibly damaging 0.75
R6259:Piezo2 UTSW 18 63117678 missense possibly damaging 0.69
R6391:Piezo2 UTSW 18 63106293 missense possibly damaging 0.79
R6446:Piezo2 UTSW 18 63086607 missense probably damaging 1.00
R6465:Piezo2 UTSW 18 63041663 missense possibly damaging 0.82
R6518:Piezo2 UTSW 18 63106271 missense probably damaging 0.99
R6521:Piezo2 UTSW 18 63021328 missense probably damaging 1.00
R6625:Piezo2 UTSW 18 63021262 missense probably damaging 1.00
R6744:Piezo2 UTSW 18 63032889 nonsense probably null
R6855:Piezo2 UTSW 18 63090879 critical splice donor site probably null
R6927:Piezo2 UTSW 18 63032986 missense probably damaging 1.00
R6980:Piezo2 UTSW 18 63082961 critical splice acceptor site probably null
R7141:Piezo2 UTSW 18 63145110 nonsense probably null
R7162:Piezo2 UTSW 18 63124709 missense possibly damaging 0.50
R7331:Piezo2 UTSW 18 63108030 missense probably damaging 0.99
R7382:Piezo2 UTSW 18 63017519 splice site probably null
R7395:Piezo2 UTSW 18 63027563 missense probably damaging 1.00
R7448:Piezo2 UTSW 18 63024472 missense probably damaging 1.00
R7465:Piezo2 UTSW 18 63012723 missense probably benign
R7517:Piezo2 UTSW 18 63082925 missense possibly damaging 0.52
R7577:Piezo2 UTSW 18 63053010 missense probably benign 0.01
R7612:Piezo2 UTSW 18 63042539 missense probably benign 0.12
X0017:Piezo2 UTSW 18 63027586 missense probably damaging 0.99
X0022:Piezo2 UTSW 18 63050610 missense probably benign 0.43
X0060:Piezo2 UTSW 18 63017577 missense probably benign 0.09
Z1088:Piezo2 UTSW 18 63069994 missense probably damaging 0.98
Predicted Primers PCR Primer

Sequencing Primer
Posted On2016-05-10