Incidental Mutation 'R5014:Nfasc'
ID385402
Institutional Source Beutler Lab
Gene Symbol Nfasc
Ensembl Gene ENSMUSG00000026442
Gene Nameneurofascin
SynonymsD430023G06Rik
MMRRC Submission 042605-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5014 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location132564690-132741797 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 132584447 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000043189] [ENSMUST00000094569] [ENSMUST00000163770] [ENSMUST00000187861]
Predicted Effect probably benign
Transcript: ENSMUST00000043189
SMART Domains Protein: ENSMUSP00000035454
Gene: ENSMUSG00000026442

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 42 131 4.5e0 SMART
IG 141 228 2.44e-7 SMART
IGc2 253 317 1.53e-17 SMART
IGc2 343 409 1.76e-8 SMART
IGc2 437 502 2.39e-10 SMART
IGc2 528 593 2.54e-5 SMART
FN3 607 690 2.17e-11 SMART
FN3 707 789 2.85e-6 SMART
FN3 805 896 2.21e-3 SMART
FN3 911 995 9.92e-6 SMART
low complexity region 996 1018 N/A INTRINSIC
transmembrane domain 1026 1048 N/A INTRINSIC
Pfam:Bravo_FIGEY 1049 1133 1.4e-29 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000094569
AA Change: V1018E
SMART Domains Protein: ENSMUSP00000092148
Gene: ENSMUSG00000026442
AA Change: V1018E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 48 137 4.5e0 SMART
IG 147 234 2.44e-7 SMART
IGc2 259 323 1.53e-17 SMART
IGc2 349 415 1.76e-8 SMART
IGc2 443 508 2.39e-10 SMART
IGc2 534 599 2.54e-5 SMART
FN3 628 711 2.17e-11 SMART
FN3 728 810 2.85e-6 SMART
FN3 825 909 9.92e-6 SMART
FN3 1010 1086 6.91e-5 SMART
transmembrane domain 1109 1131 N/A INTRINSIC
Pfam:Bravo_FIGEY 1132 1216 2.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163770
SMART Domains Protein: ENSMUSP00000132979
Gene: ENSMUSG00000026442

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 42 131 4.5e0 SMART
IG 141 228 2.44e-7 SMART
IGc2 270 334 1.53e-17 SMART
IGc2 360 426 1.76e-8 SMART
IGc2 454 519 2.39e-10 SMART
IGc2 545 610 2.54e-5 SMART
FN3 624 707 2.17e-11 SMART
FN3 724 806 2.85e-6 SMART
FN3 822 913 2.21e-3 SMART
FN3 928 1012 9.92e-6 SMART
low complexity region 1013 1035 N/A INTRINSIC
transmembrane domain 1043 1065 N/A INTRINSIC
Pfam:Bravo_FIGEY 1066 1150 5e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186330
Predicted Effect probably benign
Transcript: ENSMUST00000186389
Predicted Effect unknown
Transcript: ENSMUST00000187861
AA Change: V1125E
SMART Domains Protein: ENSMUSP00000139955
Gene: ENSMUSG00000026442
AA Change: V1125E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 48 137 1.8e-2 SMART
IG 147 234 1e-9 SMART
IGc2 259 323 6.4e-20 SMART
IGc2 349 415 7e-11 SMART
IGc2 443 508 9.7e-13 SMART
IGc2 534 599 1.1e-7 SMART
FN3 628 711 1e-13 SMART
FN3 728 810 1.4e-8 SMART
FN3 826 917 1.1e-5 SMART
FN3 932 1016 4.8e-8 SMART
FN3 1117 1193 3.4e-7 SMART
transmembrane domain 1216 1238 N/A INTRINSIC
Pfam:Bravo_FIGEY 1239 1325 2.6e-26 PFAM
Meta Mutation Damage Score 0.0919 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.7%
Validation Efficiency 97% (83/86)
MGI Phenotype FUNCTION: This gene encodes an L1 family immunoglobulin cell adhesion molecule with multiple IGcam and fibronectin domains. The protein functions in neurite outgrowth, neurite fasciculation, and organization of the axon initial segment (AIS) and nodes of Ranvier on axons during early development. Both the AIS and nodes of Ranvier contain high densities of voltage-gated Na+ (Nav) channels which are clustered by interactions with cytoskeletal and scaffolding proteins including this protein, gliomedin, ankyrin 3 (ankyrin-G), and betaIV spectrin. This protein links the AIS extracellular matrix to the intracellular cytoskeleton. This gene undergoes extensive alternative splicing, and the full-length nature of some variants has not been determined. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a null allele die within 6 to 7 days of birth, exhibit reduced nerve conduction velocity and abnormal paranodal junction formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,543,933 T1353A probably benign Het
Abca8b A T 11: 109,950,131 I1072N probably damaging Het
Atp1a2 T C 1: 172,284,871 T517A probably benign Het
Blk T G 14: 63,379,787 N257T probably benign Het
Brd4 A T 17: 32,198,398 probably benign Het
Calr4 C T 4: 109,235,797 Q25* probably null Het
Casc1 T C 6: 145,183,266 E407G probably damaging Het
Cbl T C 9: 44,154,399 probably null Het
Ccdc30 T G 4: 119,393,627 H6P possibly damaging Het
Cd101 A C 3: 101,003,823 Y840D probably damaging Het
Cd68 T A 11: 69,665,339 N178Y probably damaging Het
Cep350 T C 1: 155,928,206 T1044A probably benign Het
Cfap46 A G 7: 139,627,375 V1876A probably benign Het
Clec2g T A 6: 128,948,802 M58K probably benign Het
Clip1 T C 5: 123,617,730 E860G probably damaging Het
Col18a1 C T 10: 77,070,960 probably null Het
Cul7 A G 17: 46,655,942 *650W probably null Het
Dkk4 C T 8: 22,625,299 A55V probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnase1 C A 16: 4,039,016 Y170* probably null Het
Dnmt1 A C 9: 20,912,254 I1019S probably benign Het
Epha6 T A 16: 59,666,579 H1035L probably benign Het
Fam124b T C 1: 80,200,059 T408A probably benign Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fam71f1 C T 6: 29,326,724 probably benign Het
Galnt7 T C 8: 57,545,380 E305G probably damaging Het
Git1 T A 11: 77,498,995 V28E probably damaging Het
Gm10010 C T 6: 128,200,593 noncoding transcript Het
Gm4956 T C 1: 21,293,597 noncoding transcript Het
Gpr152 T G 19: 4,143,507 V349G probably benign Het
Gtsf1l C T 2: 163,087,192 V124I probably damaging Het
Gucy1b1 C G 3: 82,046,667 G114A probably benign Het
Hk2 T C 6: 82,743,955 Q166R possibly damaging Het
Hook2 A G 8: 84,991,377 I44M probably damaging Het
Ildr1 T A 16: 36,721,559 M222K probably damaging Het
Ints6 A T 14: 62,760,191 F55Y probably benign Het
Kcnh1 A G 1: 192,277,080 N314S probably damaging Het
Lpin3 T C 2: 160,904,828 F748L probably damaging Het
Lrsam1 T C 2: 32,936,395 probably benign Het
Msh2 A T 17: 87,717,576 K627N possibly damaging Het
Myrip A G 9: 120,422,468 Q219R probably damaging Het
Ndufb3 T A 1: 58,591,242 W51R probably damaging Het
Olfr15 T A 16: 3,839,048 I25N probably benign Het
Olfr281 T C 15: 98,456,976 V222A possibly damaging Het
Olfr90 T A 17: 37,085,554 I204F probably benign Het
P3h3 T A 6: 124,855,236 E229V probably damaging Het
Ppfia2 T A 10: 106,865,363 L837* probably null Het
Ppp2r1a G A 17: 20,958,839 probably null Het
Rabgap1 T A 2: 37,487,140 V328E probably damaging Het
Ralgapb G A 2: 158,495,535 R1138Q probably damaging Het
Ranbp2 A T 10: 58,464,120 Q498L probably benign Het
Rbx1 T A 15: 81,470,960 C56S probably damaging Het
Rcan2 T C 17: 44,017,813 F45S probably damaging Het
Rgs20 T C 1: 4,910,547 Y185C probably damaging Het
Rorc T G 3: 94,391,153 L315R probably damaging Het
Skiv2l A G 17: 34,847,425 V194A probably benign Het
Slc13a2 T C 11: 78,400,161 K406E possibly damaging Het
Slc35g3 T A 11: 69,761,040 K62* probably null Het
Sox30 T C 11: 45,991,909 S589P probably benign Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Ssh2 T A 11: 77,455,276 C1362* probably null Het
Tecta C T 9: 42,373,242 C849Y probably damaging Het
Thbs1 T A 2: 118,120,037 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tyk2 C T 9: 21,115,830 probably null Het
Tyw5 C A 1: 57,406,845 probably benign Het
Vcp T C 4: 42,980,828 T761A probably benign Het
Wdfy4 A T 14: 33,100,940 C1401S probably benign Het
Wiz T C 17: 32,359,366 N391D probably damaging Het
Ylpm1 G A 12: 85,014,749 E475K unknown Het
Zcchc11 T C 4: 108,526,846 probably benign Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp184 A G 13: 21,958,424 D100G probably benign Het
Zfp990 T A 4: 145,538,099 C556S possibly damaging Het
Zkscan16 C T 4: 58,951,892 P189L probably damaging Het
Other mutations in Nfasc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Nfasc APN 1 132573798 nonsense probably null
IGL01088:Nfasc APN 1 132642776 utr 5 prime probably benign
IGL01958:Nfasc APN 1 132608438 nonsense probably null
IGL01999:Nfasc APN 1 132605247 splice site probably benign
IGL02170:Nfasc APN 1 132610366 nonsense probably null
IGL02187:Nfasc APN 1 132570481 missense probably damaging 1.00
IGL02192:Nfasc APN 1 132570481 missense probably damaging 1.00
IGL02452:Nfasc APN 1 132620924 critical splice donor site probably null
IGL02698:Nfasc APN 1 132634737 missense probably benign 0.06
IGL02797:Nfasc APN 1 132610448 missense probably damaging 1.00
IGL03000:Nfasc APN 1 132621509 splice site probably benign
IGL03027:Nfasc APN 1 132610469 missense probably damaging 1.00
jiggle UTSW 1 132602021 missense probably damaging 1.00
Tremble UTSW 1 132611595 missense probably damaging 1.00
PIT4377001:Nfasc UTSW 1 132583066 missense unknown
R0240:Nfasc UTSW 1 132601983 missense probably damaging 1.00
R0240:Nfasc UTSW 1 132601983 missense probably damaging 1.00
R0241:Nfasc UTSW 1 132636993 missense probably benign 0.02
R0241:Nfasc UTSW 1 132636993 missense probably benign 0.02
R0418:Nfasc UTSW 1 132611595 missense probably damaging 1.00
R0513:Nfasc UTSW 1 132603846 missense possibly damaging 0.95
R0639:Nfasc UTSW 1 132603816 missense probably damaging 1.00
R0646:Nfasc UTSW 1 132608438 nonsense probably null
R1103:Nfasc UTSW 1 132607057 splice site probably benign
R1269:Nfasc UTSW 1 132610788 missense probably damaging 1.00
R1550:Nfasc UTSW 1 132608503 missense probably damaging 0.96
R1749:Nfasc UTSW 1 132611632 missense probably damaging 1.00
R1773:Nfasc UTSW 1 132610839 missense probably damaging 1.00
R1921:Nfasc UTSW 1 132610805 missense probably damaging 1.00
R1987:Nfasc UTSW 1 132610886 missense probably damaging 1.00
R2141:Nfasc UTSW 1 132596645 missense probably damaging 1.00
R2239:Nfasc UTSW 1 132583022 intron probably benign
R2413:Nfasc UTSW 1 132595505 missense probably damaging 1.00
R2428:Nfasc UTSW 1 132595654 missense possibly damaging 0.55
R2472:Nfasc UTSW 1 132588221 intron probably benign
R2517:Nfasc UTSW 1 132597763 unclassified probably null
R3850:Nfasc UTSW 1 132631733 missense probably damaging 1.00
R4050:Nfasc UTSW 1 132610305 splice site probably benign
R4061:Nfasc UTSW 1 132597845 missense probably damaging 1.00
R4088:Nfasc UTSW 1 132595591 missense probably damaging 1.00
R4342:Nfasc UTSW 1 132631705 missense probably damaging 1.00
R4343:Nfasc UTSW 1 132631705 missense probably damaging 1.00
R4345:Nfasc UTSW 1 132631705 missense probably damaging 1.00
R4452:Nfasc UTSW 1 132634671 missense probably damaging 1.00
R4818:Nfasc UTSW 1 132603830 missense possibly damaging 0.87
R4851:Nfasc UTSW 1 132602021 missense probably damaging 1.00
R5768:Nfasc UTSW 1 132605145 missense probably benign 0.00
R6145:Nfasc UTSW 1 132634717 missense probably damaging 1.00
R6335:Nfasc UTSW 1 132576394 missense probably damaging 0.98
R6379:Nfasc UTSW 1 132570542 nonsense probably null
R6486:Nfasc UTSW 1 132605214 missense probably damaging 1.00
R7022:Nfasc UTSW 1 132621049 missense probably damaging 1.00
R7062:Nfasc UTSW 1 132601969 critical splice donor site probably null
R7084:Nfasc UTSW 1 132570509 missense unknown
R7275:Nfasc UTSW 1 132634263 missense probably damaging 1.00
R7286:Nfasc UTSW 1 132602052 missense probably damaging 1.00
R7682:Nfasc UTSW 1 132573773 missense unknown
R7838:Nfasc UTSW 1 132605549 missense probably damaging 1.00
R7871:Nfasc UTSW 1 132600013 missense not run
R7921:Nfasc UTSW 1 132605549 missense probably damaging 1.00
R7954:Nfasc UTSW 1 132600013 missense not run
Z1176:Nfasc UTSW 1 132634638 missense probably benign 0.00
Z1177:Nfasc UTSW 1 132631838 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAAGCCTGAGGGAGTTCAAC -3'
(R):5'- ATCAAGACGGCAGCCTGTAG -3'

Sequencing Primer
(F):5'- CAGGATCTCCTTAATGGGCATCTAG -3'
(R):5'- CCTGTAGCTCTACTGGGCTGAG -3'
Posted On2016-05-10