Incidental Mutation 'R5014:Lrsam1'
ID385406
Institutional Source Beutler Lab
Gene Symbol Lrsam1
Ensembl Gene ENSMUSG00000026792
Gene Nameleucine rich repeat and sterile alpha motif containing 1
Synonyms
MMRRC Submission 042605-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R5014 (G1)
Quality Score150
Status Validated
Chromosome2
Chromosomal Location32925216-32961614 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 32936395 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000028132] [ENSMUST00000113200]
Predicted Effect probably benign
Transcript: ENSMUST00000028132
SMART Domains Protein: ENSMUSP00000028132
Gene: ENSMUSG00000026792

DomainStartEndE-ValueType
LRR 80 102 1.26e1 SMART
LRR 103 125 9.3e-1 SMART
LRR 126 148 1.91e1 SMART
LRR 149 171 7.05e-1 SMART
Blast:IlGF 191 321 1e-71 BLAST
low complexity region 322 333 N/A INTRINSIC
low complexity region 474 493 N/A INTRINSIC
coiled coil region 500 547 N/A INTRINSIC
SAM 566 632 2.42e-2 SMART
RING 679 713 3.51e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113200
SMART Domains Protein: ENSMUSP00000108825
Gene: ENSMUSG00000026792

DomainStartEndE-ValueType
LRR 80 102 1.26e1 SMART
LRR 103 125 9.3e-1 SMART
LRR 126 148 1.91e1 SMART
LRR 149 171 7.05e-1 SMART
Blast:IlGF 191 321 1e-71 BLAST
low complexity region 322 333 N/A INTRINSIC
low complexity region 474 493 N/A INTRINSIC
coiled coil region 500 547 N/A INTRINSIC
SAM 566 632 2.42e-2 SMART
RING 679 713 3.51e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195713
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195776
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.7%
Validation Efficiency 97% (83/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ring finger protein involved in a variety of functions, including regulation of signaling pathways and cell adhesion, mediation of self-ubiquitylation, and involvement in cargo sorting during receptor endocytosis. Mutations in this gene have been associated with Charcot-Marie-Tooth disease. Multiple transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mutant mice either heterozygous or homozygous for a gene trapped allele exhibit mild neuromuscular junction and axonal defects in the absence of a neuronal challenge, but show increased sensitivity to acrylamide-induced motor axon degeneration relative to control mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,543,933 T1353A probably benign Het
Abca8b A T 11: 109,950,131 I1072N probably damaging Het
Atp1a2 T C 1: 172,284,871 T517A probably benign Het
Blk T G 14: 63,379,787 N257T probably benign Het
Brd4 A T 17: 32,198,398 probably benign Het
Calr4 C T 4: 109,235,797 Q25* probably null Het
Casc1 T C 6: 145,183,266 E407G probably damaging Het
Cbl T C 9: 44,154,399 probably null Het
Ccdc30 T G 4: 119,393,627 H6P possibly damaging Het
Cd101 A C 3: 101,003,823 Y840D probably damaging Het
Cd68 T A 11: 69,665,339 N178Y probably damaging Het
Cep350 T C 1: 155,928,206 T1044A probably benign Het
Cfap46 A G 7: 139,627,375 V1876A probably benign Het
Clec2g T A 6: 128,948,802 M58K probably benign Het
Clip1 T C 5: 123,617,730 E860G probably damaging Het
Col18a1 C T 10: 77,070,960 probably null Het
Cul7 A G 17: 46,655,942 *650W probably null Het
Dkk4 C T 8: 22,625,299 A55V probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnase1 C A 16: 4,039,016 Y170* probably null Het
Dnmt1 A C 9: 20,912,254 I1019S probably benign Het
Epha6 T A 16: 59,666,579 H1035L probably benign Het
Fam124b T C 1: 80,200,059 T408A probably benign Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fam71f1 C T 6: 29,326,724 probably benign Het
Galnt7 T C 8: 57,545,380 E305G probably damaging Het
Git1 T A 11: 77,498,995 V28E probably damaging Het
Gm10010 C T 6: 128,200,593 noncoding transcript Het
Gm4956 T C 1: 21,293,597 noncoding transcript Het
Gpr152 T G 19: 4,143,507 V349G probably benign Het
Gtsf1l C T 2: 163,087,192 V124I probably damaging Het
Gucy1b1 C G 3: 82,046,667 G114A probably benign Het
Hk2 T C 6: 82,743,955 Q166R possibly damaging Het
Hook2 A G 8: 84,991,377 I44M probably damaging Het
Ildr1 T A 16: 36,721,559 M222K probably damaging Het
Ints6 A T 14: 62,760,191 F55Y probably benign Het
Kcnh1 A G 1: 192,277,080 N314S probably damaging Het
Lpin3 T C 2: 160,904,828 F748L probably damaging Het
Msh2 A T 17: 87,717,576 K627N possibly damaging Het
Myrip A G 9: 120,422,468 Q219R probably damaging Het
Ndufb3 T A 1: 58,591,242 W51R probably damaging Het
Nfasc A T 1: 132,584,447 probably benign Het
Olfr15 T A 16: 3,839,048 I25N probably benign Het
Olfr281 T C 15: 98,456,976 V222A possibly damaging Het
Olfr90 T A 17: 37,085,554 I204F probably benign Het
P3h3 T A 6: 124,855,236 E229V probably damaging Het
Ppfia2 T A 10: 106,865,363 L837* probably null Het
Ppp2r1a G A 17: 20,958,839 probably null Het
Rabgap1 T A 2: 37,487,140 V328E probably damaging Het
Ralgapb G A 2: 158,495,535 R1138Q probably damaging Het
Ranbp2 A T 10: 58,464,120 Q498L probably benign Het
Rbx1 T A 15: 81,470,960 C56S probably damaging Het
Rcan2 T C 17: 44,017,813 F45S probably damaging Het
Rgs20 T C 1: 4,910,547 Y185C probably damaging Het
Rorc T G 3: 94,391,153 L315R probably damaging Het
Skiv2l A G 17: 34,847,425 V194A probably benign Het
Slc13a2 T C 11: 78,400,161 K406E possibly damaging Het
Slc35g3 T A 11: 69,761,040 K62* probably null Het
Sox30 T C 11: 45,991,909 S589P probably benign Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Ssh2 T A 11: 77,455,276 C1362* probably null Het
Tecta C T 9: 42,373,242 C849Y probably damaging Het
Thbs1 T A 2: 118,120,037 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tyk2 C T 9: 21,115,830 probably null Het
Tyw5 C A 1: 57,406,845 probably benign Het
Vcp T C 4: 42,980,828 T761A probably benign Het
Wdfy4 A T 14: 33,100,940 C1401S probably benign Het
Wiz T C 17: 32,359,366 N391D probably damaging Het
Ylpm1 G A 12: 85,014,749 E475K unknown Het
Zcchc11 T C 4: 108,526,846 probably benign Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp184 A G 13: 21,958,424 D100G probably benign Het
Zfp990 T A 4: 145,538,099 C556S possibly damaging Het
Zkscan16 C T 4: 58,951,892 P189L probably damaging Het
Other mutations in Lrsam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Lrsam1 APN 2 32955173 splice site probably benign
IGL01407:Lrsam1 APN 2 32947903 missense probably damaging 0.99
IGL01565:Lrsam1 APN 2 32936495 missense probably damaging 1.00
IGL01985:Lrsam1 APN 2 32928091 missense probably benign
IGL02743:Lrsam1 APN 2 32928649 splice site probably null
R0240:Lrsam1 UTSW 2 32955185 missense probably damaging 1.00
R0591:Lrsam1 UTSW 2 32933923 splice site probably benign
R0845:Lrsam1 UTSW 2 32953443 missense possibly damaging 0.94
R0945:Lrsam1 UTSW 2 32947909 missense probably benign 0.04
R1475:Lrsam1 UTSW 2 32954265 missense possibly damaging 0.48
R2147:Lrsam1 UTSW 2 32945879 missense probably damaging 1.00
R3790:Lrsam1 UTSW 2 32958159 missense probably null 1.00
R4374:Lrsam1 UTSW 2 32955191 missense possibly damaging 0.79
R4822:Lrsam1 UTSW 2 32926792 missense probably damaging 0.99
R5472:Lrsam1 UTSW 2 32945858 frame shift probably null
R5566:Lrsam1 UTSW 2 32941858 missense probably damaging 1.00
R5640:Lrsam1 UTSW 2 32945852 missense probably benign 0.13
R5992:Lrsam1 UTSW 2 32955222 missense probably benign 0.00
R7513:Lrsam1 UTSW 2 32953485 missense probably benign 0.02
R7515:Lrsam1 UTSW 2 32940239 critical splice donor site probably null
R8113:Lrsam1 UTSW 2 32947889 missense possibly damaging 0.94
Z1176:Lrsam1 UTSW 2 32941814 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGAGTCCTGTAAGCGCTG -3'
(R):5'- GCATGAGCACCCTTGTAAGAGC -3'

Sequencing Primer
(F):5'- TTAGGGAAACACACTGCACTTG -3'
(R):5'- ACCCTTGTAAGAGCCAGGG -3'
Posted On2016-05-10