Incidental Mutation 'R5014:Cd101'
ID385416
Institutional Source Beutler Lab
Gene Symbol Cd101
Ensembl Gene ENSMUSG00000086564
Gene NameCD101 antigen
SynonymsIgsf2, LOC381460
MMRRC Submission 042605-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5014 (G1)
Quality Score89
Status Validated
Chromosome3
Chromosomal Location100993529-101029556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 101003823 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 840 (Y840D)
Ref Sequence ENSEMBL: ENSMUSP00000126027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000147399] [ENSMUST00000167086]
Predicted Effect probably damaging
Transcript: ENSMUST00000147399
AA Change: Y844D

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116643
Gene: ENSMUSG00000086564
AA Change: Y844D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 28 143 4.96e-8 SMART
IG 153 266 4.74e-5 SMART
IG_like 274 379 2.19e-1 SMART
IG 289 395 3.25e-3 SMART
IG 417 533 4.85e-11 SMART
IG 545 659 1.52e-3 SMART
IG 680 805 3.16e-1 SMART
IG_like 827 927 2.95e-1 SMART
IG 856 955 1.04e-1 SMART
transmembrane domain 971 993 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167086
AA Change: Y840D

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126027
Gene: ENSMUSG00000086564
AA Change: Y840D

DomainStartEndE-ValueType
IG 24 139 4.96e-8 SMART
IG 149 262 4.74e-5 SMART
IG_like 270 375 2.19e-1 SMART
IG 285 391 3.25e-3 SMART
IG 413 529 4.85e-11 SMART
IG 541 655 1.52e-3 SMART
IG 676 801 3.16e-1 SMART
IG_like 823 923 2.95e-1 SMART
IG 852 951 1.04e-1 SMART
transmembrane domain 967 989 N/A INTRINSIC
Meta Mutation Damage Score 0.7422 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.7%
Validation Efficiency 97% (83/86)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced Gr-1+ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,543,933 T1353A probably benign Het
Abca8b A T 11: 109,950,131 I1072N probably damaging Het
Atp1a2 T C 1: 172,284,871 T517A probably benign Het
Blk T G 14: 63,379,787 N257T probably benign Het
Brd4 A T 17: 32,198,398 probably benign Het
Calr4 C T 4: 109,235,797 Q25* probably null Het
Casc1 T C 6: 145,183,266 E407G probably damaging Het
Cbl T C 9: 44,154,399 probably null Het
Ccdc30 T G 4: 119,393,627 H6P possibly damaging Het
Cd68 T A 11: 69,665,339 N178Y probably damaging Het
Cep350 T C 1: 155,928,206 T1044A probably benign Het
Cfap46 A G 7: 139,627,375 V1876A probably benign Het
Clec2g T A 6: 128,948,802 M58K probably benign Het
Clip1 T C 5: 123,617,730 E860G probably damaging Het
Col18a1 C T 10: 77,070,960 probably null Het
Cul7 A G 17: 46,655,942 *650W probably null Het
Dkk4 C T 8: 22,625,299 A55V probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnase1 C A 16: 4,039,016 Y170* probably null Het
Dnmt1 A C 9: 20,912,254 I1019S probably benign Het
Epha6 T A 16: 59,666,579 H1035L probably benign Het
Fam124b T C 1: 80,200,059 T408A probably benign Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fam71f1 C T 6: 29,326,724 probably benign Het
Galnt7 T C 8: 57,545,380 E305G probably damaging Het
Git1 T A 11: 77,498,995 V28E probably damaging Het
Gm10010 C T 6: 128,200,593 noncoding transcript Het
Gm4956 T C 1: 21,293,597 noncoding transcript Het
Gpr152 T G 19: 4,143,507 V349G probably benign Het
Gtsf1l C T 2: 163,087,192 V124I probably damaging Het
Gucy1b1 C G 3: 82,046,667 G114A probably benign Het
Hk2 T C 6: 82,743,955 Q166R possibly damaging Het
Hook2 A G 8: 84,991,377 I44M probably damaging Het
Ildr1 T A 16: 36,721,559 M222K probably damaging Het
Ints6 A T 14: 62,760,191 F55Y probably benign Het
Kcnh1 A G 1: 192,277,080 N314S probably damaging Het
Lpin3 T C 2: 160,904,828 F748L probably damaging Het
Lrsam1 T C 2: 32,936,395 probably benign Het
Msh2 A T 17: 87,717,576 K627N possibly damaging Het
Myrip A G 9: 120,422,468 Q219R probably damaging Het
Ndufb3 T A 1: 58,591,242 W51R probably damaging Het
Nfasc A T 1: 132,584,447 probably benign Het
Olfr15 T A 16: 3,839,048 I25N probably benign Het
Olfr281 T C 15: 98,456,976 V222A possibly damaging Het
Olfr90 T A 17: 37,085,554 I204F probably benign Het
P3h3 T A 6: 124,855,236 E229V probably damaging Het
Ppfia2 T A 10: 106,865,363 L837* probably null Het
Ppp2r1a G A 17: 20,958,839 probably null Het
Rabgap1 T A 2: 37,487,140 V328E probably damaging Het
Ralgapb G A 2: 158,495,535 R1138Q probably damaging Het
Ranbp2 A T 10: 58,464,120 Q498L probably benign Het
Rbx1 T A 15: 81,470,960 C56S probably damaging Het
Rcan2 T C 17: 44,017,813 F45S probably damaging Het
Rgs20 T C 1: 4,910,547 Y185C probably damaging Het
Rorc T G 3: 94,391,153 L315R probably damaging Het
Skiv2l A G 17: 34,847,425 V194A probably benign Het
Slc13a2 T C 11: 78,400,161 K406E possibly damaging Het
Slc35g3 T A 11: 69,761,040 K62* probably null Het
Sox30 T C 11: 45,991,909 S589P probably benign Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Ssh2 T A 11: 77,455,276 C1362* probably null Het
Tecta C T 9: 42,373,242 C849Y probably damaging Het
Thbs1 T A 2: 118,120,037 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tyk2 C T 9: 21,115,830 probably null Het
Tyw5 C A 1: 57,406,845 probably benign Het
Vcp T C 4: 42,980,828 T761A probably benign Het
Wdfy4 A T 14: 33,100,940 C1401S probably benign Het
Wiz T C 17: 32,359,366 N391D probably damaging Het
Ylpm1 G A 12: 85,014,749 E475K unknown Het
Zcchc11 T C 4: 108,526,846 probably benign Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp184 A G 13: 21,958,424 D100G probably benign Het
Zfp990 T A 4: 145,538,099 C556S possibly damaging Het
Zkscan16 C T 4: 58,951,892 P189L probably damaging Het
Other mutations in Cd101
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Cd101 APN 3 101003702 missense probably damaging 1.00
IGL01443:Cd101 APN 3 101003571 missense probably benign
IGL02000:Cd101 APN 3 101012082 missense probably benign 0.11
IGL02178:Cd101 APN 3 100993766 missense probably damaging 1.00
IGL02224:Cd101 APN 3 101017002 missense probably benign
IGL02450:Cd101 APN 3 100993738 missense probably damaging 0.99
IGL02502:Cd101 APN 3 101011825 missense probably damaging 0.99
IGL02536:Cd101 APN 3 101003597 missense probably damaging 1.00
IGL02749:Cd101 APN 3 101020399 missense probably damaging 1.00
IGL02818:Cd101 APN 3 101011929 missense probably damaging 1.00
IGL02829:Cd101 APN 3 101018565 splice site probably benign
IGL02902:Cd101 APN 3 101018994 splice site probably benign
tax_day UTSW 3 101003705 missense possibly damaging 0.86
R0069:Cd101 UTSW 3 101008217 missense probably benign 0.08
R0069:Cd101 UTSW 3 101008217 missense probably benign 0.08
R0411:Cd101 UTSW 3 101018527 splice site probably null
R0486:Cd101 UTSW 3 101008092 missense possibly damaging 0.94
R0556:Cd101 UTSW 3 101020654 missense probably damaging 1.00
R0726:Cd101 UTSW 3 101020622 missense possibly damaging 0.95
R0966:Cd101 UTSW 3 101008222 missense probably benign 0.13
R1344:Cd101 UTSW 3 101018775 nonsense probably null
R1418:Cd101 UTSW 3 101018775 nonsense probably null
R1547:Cd101 UTSW 3 101018951 missense possibly damaging 0.94
R1551:Cd101 UTSW 3 101012013 missense probably damaging 0.99
R1845:Cd101 UTSW 3 101029448 splice site probably null
R1919:Cd101 UTSW 3 101018917 missense probably damaging 1.00
R1976:Cd101 UTSW 3 101008061 missense probably damaging 0.96
R2260:Cd101 UTSW 3 101016945 missense possibly damaging 0.82
R2679:Cd101 UTSW 3 100993763 missense probably benign 0.00
R2873:Cd101 UTSW 3 101003848 missense probably benign 0.00
R3606:Cd101 UTSW 3 101020597 missense probably damaging 1.00
R4201:Cd101 UTSW 3 101018685 missense probably damaging 1.00
R4202:Cd101 UTSW 3 101018685 missense probably damaging 1.00
R4205:Cd101 UTSW 3 101018685 missense probably damaging 1.00
R4349:Cd101 UTSW 3 101013314 missense possibly damaging 0.93
R4574:Cd101 UTSW 3 101013153 missense probably benign 0.02
R4601:Cd101 UTSW 3 100993888 missense possibly damaging 0.84
R4820:Cd101 UTSW 3 101022155 missense probably benign 0.01
R4910:Cd101 UTSW 3 100993889 missense probably benign 0.13
R5081:Cd101 UTSW 3 101003705 missense possibly damaging 0.86
R5396:Cd101 UTSW 3 101018810 missense probably damaging 1.00
R5425:Cd101 UTSW 3 101018686 missense probably damaging 1.00
R6193:Cd101 UTSW 3 101020462 missense probably damaging 1.00
R6210:Cd101 UTSW 3 101018643 missense probably damaging 1.00
R6732:Cd101 UTSW 3 101008199 missense probably benign 0.01
R6830:Cd101 UTSW 3 100993696 missense probably benign 0.12
R6897:Cd101 UTSW 3 101013060 missense probably damaging 1.00
R6940:Cd101 UTSW 3 101003702 missense probably damaging 1.00
R7335:Cd101 UTSW 3 101018729 missense probably benign 0.01
R7565:Cd101 UTSW 3 101018792 missense probably benign 0.00
R7880:Cd101 UTSW 3 101007866 missense probably benign 0.00
R8121:Cd101 UTSW 3 101020582 missense probably damaging 1.00
R8233:Cd101 UTSW 3 100993673 missense unknown
R8900:Cd101 UTSW 3 101018746 missense probably benign 0.19
R8960:Cd101 UTSW 3 101003501 missense probably benign 0.01
X0018:Cd101 UTSW 3 101018632 missense possibly damaging 0.95
X0023:Cd101 UTSW 3 101018855 missense probably benign
X0058:Cd101 UTSW 3 101020421 missense probably damaging 1.00
Z1177:Cd101 UTSW 3 101011916 missense probably benign 0.03
Z1177:Cd101 UTSW 3 101017140 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCCATTTCCACCCGATGCAG -3'
(R):5'- CCAGTGGAAATGATAGGGCTC -3'

Sequencing Primer
(F):5'- ACCCGATGCAGCTTCAGGAC -3'
(R):5'- TAGGGCTCAGAGGTGGC -3'
Posted On2016-05-10