Incidental Mutation 'R5014:Dnmt1'
ID385433
Institutional Source Beutler Lab
Gene Symbol Dnmt1
Ensembl Gene ENSMUSG00000004099
Gene NameDNA methyltransferase (cytosine-5) 1
SynonymsMTase, Dnmt1o, Cxxc9, MommeD2
MMRRC Submission 042605-MU
Accession Numbers

Genbank: NM_010066

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5014 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location20907209-20959888 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 20912254 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 1019 (I1019S)
Ref Sequence ENSEMBL: ENSMUSP00000150433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004202] [ENSMUST00000177754] [ENSMUST00000178110] [ENSMUST00000216540]
Predicted Effect probably benign
Transcript: ENSMUST00000004202
AA Change: I1137S

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000004202
Gene: ENSMUSG00000004099
AA Change: I1137S

DomainStartEndE-ValueType
DMAP_binding 16 106 1.7e-13 SMART
low complexity region 121 143 N/A INTRINSIC
low complexity region 156 166 N/A INTRINSIC
low complexity region 180 194 N/A INTRINSIC
low complexity region 273 290 N/A INTRINSIC
low complexity region 306 328 N/A INTRINSIC
Pfam:DNMT1-RFD 405 540 4.8e-46 PFAM
low complexity region 610 625 N/A INTRINSIC
Pfam:zf-CXXC 648 694 2.7e-17 PFAM
low complexity region 701 711 N/A INTRINSIC
low complexity region 719 731 N/A INTRINSIC
BAH 758 884 4.62e-31 SMART
BAH 935 1103 1.79e-37 SMART
low complexity region 1110 1124 N/A INTRINSIC
Pfam:DNA_methylase 1142 1596 1.3e-49 PFAM
low complexity region 1600 1619 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177754
AA Change: I1018S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000136982
Gene: ENSMUSG00000004099
AA Change: I1018S

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
low complexity region 37 47 N/A INTRINSIC
low complexity region 61 75 N/A INTRINSIC
low complexity region 154 171 N/A INTRINSIC
low complexity region 187 209 N/A INTRINSIC
Pfam:DNMT1-RFD 286 421 3.4e-40 PFAM
low complexity region 491 506 N/A INTRINSIC
Pfam:zf-CXXC 529 575 2.3e-17 PFAM
low complexity region 582 592 N/A INTRINSIC
low complexity region 600 612 N/A INTRINSIC
BAH 639 765 4.62e-31 SMART
BAH 816 984 1.79e-37 SMART
low complexity region 991 1005 N/A INTRINSIC
Pfam:DNA_methylase 1023 1477 1.3e-49 PFAM
low complexity region 1481 1500 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178110
AA Change: I1018S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000136669
Gene: ENSMUSG00000004099
AA Change: I1018S

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
low complexity region 38 48 N/A INTRINSIC
low complexity region 62 76 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
Pfam:DNMT1-RFD 287 422 2.6e-40 PFAM
low complexity region 492 507 N/A INTRINSIC
Pfam:zf-CXXC 530 576 4.7e-17 PFAM
low complexity region 583 593 N/A INTRINSIC
low complexity region 601 613 N/A INTRINSIC
BAH 640 766 4.62e-31 SMART
BAH 817 985 1.79e-37 SMART
low complexity region 992 1006 N/A INTRINSIC
Pfam:DNA_methylase 1024 1478 8e-50 PFAM
low complexity region 1482 1501 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214964
Predicted Effect probably benign
Transcript: ENSMUST00000216540
AA Change: I1019S

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.0995 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.7%
Validation Efficiency 97% (83/86)
MGI Phenotype FUNCTION: This gene encodes a methyltransferase that preferentially methylates cytosines of CpG residues in hemimethylated DNA to generate fully methylated CpG base pairs during DNA replication. This enzyme plays roles in diverse cellular processes including cell cycle regulation, DNA repair, and telomere maintenance. The encoded protein is composed of an N-terminal domain with a nuclear localization sequence and replication fork-targeting domain, a DNA-binding CXXC domain, two bromo-adjacent homology domains, and a C-terminal catalytic domain. Mouse embryonic stem cells mutant for this gene are viable, but when introduced into the germ line, cause a recessive lethal phenotype with mutant embryos displaying stunted growth and developmental defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutations causing partial or severe loss of function were homozygous lethal by embryonic day 9.5, with lack of appropriate genomic imprinting observed at several loci. [provided by MGI curators]
Allele List at MGI

All alleles(109) : Targeted, knock-out(5) Targeted, other(11) Gene trapped(92) Chemically induced(1)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,543,933 T1353A probably benign Het
Abca8b A T 11: 109,950,131 I1072N probably damaging Het
Atp1a2 T C 1: 172,284,871 T517A probably benign Het
Blk T G 14: 63,379,787 N257T probably benign Het
Brd4 A T 17: 32,198,398 probably benign Het
Calr4 C T 4: 109,235,797 Q25* probably null Het
Casc1 T C 6: 145,183,266 E407G probably damaging Het
Cbl T C 9: 44,154,399 probably null Het
Ccdc30 T G 4: 119,393,627 H6P possibly damaging Het
Cd101 A C 3: 101,003,823 Y840D probably damaging Het
Cd68 T A 11: 69,665,339 N178Y probably damaging Het
Cep350 T C 1: 155,928,206 T1044A probably benign Het
Cfap46 A G 7: 139,627,375 V1876A probably benign Het
Clec2g T A 6: 128,948,802 M58K probably benign Het
Clip1 T C 5: 123,617,730 E860G probably damaging Het
Col18a1 C T 10: 77,070,960 probably null Het
Cul7 A G 17: 46,655,942 *650W probably null Het
Dkk4 C T 8: 22,625,299 A55V probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnase1 C A 16: 4,039,016 Y170* probably null Het
Epha6 T A 16: 59,666,579 H1035L probably benign Het
Fam124b T C 1: 80,200,059 T408A probably benign Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fam71f1 C T 6: 29,326,724 probably benign Het
Galnt7 T C 8: 57,545,380 E305G probably damaging Het
Git1 T A 11: 77,498,995 V28E probably damaging Het
Gm10010 C T 6: 128,200,593 noncoding transcript Het
Gm4956 T C 1: 21,293,597 noncoding transcript Het
Gpr152 T G 19: 4,143,507 V349G probably benign Het
Gtsf1l C T 2: 163,087,192 V124I probably damaging Het
Gucy1b1 C G 3: 82,046,667 G114A probably benign Het
Hk2 T C 6: 82,743,955 Q166R possibly damaging Het
Hook2 A G 8: 84,991,377 I44M probably damaging Het
Ildr1 T A 16: 36,721,559 M222K probably damaging Het
Ints6 A T 14: 62,760,191 F55Y probably benign Het
Kcnh1 A G 1: 192,277,080 N314S probably damaging Het
Lpin3 T C 2: 160,904,828 F748L probably damaging Het
Lrsam1 T C 2: 32,936,395 probably benign Het
Msh2 A T 17: 87,717,576 K627N possibly damaging Het
Myrip A G 9: 120,422,468 Q219R probably damaging Het
Ndufb3 T A 1: 58,591,242 W51R probably damaging Het
Nfasc A T 1: 132,584,447 probably benign Het
Olfr15 T A 16: 3,839,048 I25N probably benign Het
Olfr281 T C 15: 98,456,976 V222A possibly damaging Het
Olfr90 T A 17: 37,085,554 I204F probably benign Het
P3h3 T A 6: 124,855,236 E229V probably damaging Het
Ppfia2 T A 10: 106,865,363 L837* probably null Het
Ppp2r1a G A 17: 20,958,839 probably null Het
Rabgap1 T A 2: 37,487,140 V328E probably damaging Het
Ralgapb G A 2: 158,495,535 R1138Q probably damaging Het
Ranbp2 A T 10: 58,464,120 Q498L probably benign Het
Rbx1 T A 15: 81,470,960 C56S probably damaging Het
Rcan2 T C 17: 44,017,813 F45S probably damaging Het
Rgs20 T C 1: 4,910,547 Y185C probably damaging Het
Rorc T G 3: 94,391,153 L315R probably damaging Het
Skiv2l A G 17: 34,847,425 V194A probably benign Het
Slc13a2 T C 11: 78,400,161 K406E possibly damaging Het
Slc35g3 T A 11: 69,761,040 K62* probably null Het
Sox30 T C 11: 45,991,909 S589P probably benign Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Ssh2 T A 11: 77,455,276 C1362* probably null Het
Tecta C T 9: 42,373,242 C849Y probably damaging Het
Thbs1 T A 2: 118,120,037 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tyk2 C T 9: 21,115,830 probably null Het
Tyw5 C A 1: 57,406,845 probably benign Het
Vcp T C 4: 42,980,828 T761A probably benign Het
Wdfy4 A T 14: 33,100,940 C1401S probably benign Het
Wiz T C 17: 32,359,366 N391D probably damaging Het
Ylpm1 G A 12: 85,014,749 E475K unknown Het
Zcchc11 T C 4: 108,526,846 probably benign Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp184 A G 13: 21,958,424 D100G probably benign Het
Zfp990 T A 4: 145,538,099 C556S possibly damaging Het
Zkscan16 C T 4: 58,951,892 P189L probably damaging Het
Other mutations in Dnmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Dnmt1 APN 9 20910270 missense possibly damaging 0.94
IGL01093:Dnmt1 APN 9 20909785 missense possibly damaging 0.88
IGL01160:Dnmt1 APN 9 20917319 missense possibly damaging 0.90
IGL01704:Dnmt1 APN 9 20910180 missense probably damaging 1.00
IGL02105:Dnmt1 APN 9 20907882 missense unknown
IGL02124:Dnmt1 APN 9 20908549 missense probably damaging 1.00
IGL02188:Dnmt1 APN 9 20941738 nonsense probably null
IGL02409:Dnmt1 APN 9 20926497 missense probably benign 0.00
IGL02579:Dnmt1 APN 9 20918120 missense possibly damaging 0.79
IGL02625:Dnmt1 APN 9 20927146 missense probably benign 0.01
IGL02794:Dnmt1 APN 9 20936551 missense probably benign
IGL02795:Dnmt1 APN 9 20927111 missense probably benign 0.12
IGL02938:Dnmt1 APN 9 20941373 missense probably benign 0.23
IGL03245:Dnmt1 APN 9 20915760 missense probably damaging 0.99
IGL03303:Dnmt1 APN 9 20926710 missense probably benign
B5639:Dnmt1 UTSW 9 20907968 splice site probably benign
PIT4576001:Dnmt1 UTSW 9 20911775 missense probably benign 0.28
R0071:Dnmt1 UTSW 9 20908620 missense probably damaging 0.99
R0180:Dnmt1 UTSW 9 20908620 missense probably damaging 0.99
R0368:Dnmt1 UTSW 9 20941757 missense probably damaging 0.99
R0387:Dnmt1 UTSW 9 20918213 missense probably damaging 1.00
R0529:Dnmt1 UTSW 9 20911550 missense probably damaging 1.00
R0532:Dnmt1 UTSW 9 20918556 splice site probably benign
R0612:Dnmt1 UTSW 9 20918193 missense probably damaging 0.98
R1109:Dnmt1 UTSW 9 20922388 missense probably damaging 1.00
R1298:Dnmt1 UTSW 9 20941456 missense probably benign
R1345:Dnmt1 UTSW 9 20908518 missense probably damaging 1.00
R1472:Dnmt1 UTSW 9 20932176 missense probably benign 0.28
R1654:Dnmt1 UTSW 9 20936574 missense possibly damaging 0.75
R1817:Dnmt1 UTSW 9 20927126 missense probably benign
R1836:Dnmt1 UTSW 9 20918246 missense probably damaging 1.00
R1957:Dnmt1 UTSW 9 20927146 missense probably benign 0.01
R1958:Dnmt1 UTSW 9 20927146 missense probably benign 0.01
R2097:Dnmt1 UTSW 9 20909788 missense probably benign 0.00
R2145:Dnmt1 UTSW 9 20937155 splice site probably benign
R2326:Dnmt1 UTSW 9 20924146 splice site probably benign
R4199:Dnmt1 UTSW 9 20938118 missense probably benign 0.00
R4456:Dnmt1 UTSW 9 20909842 missense probably damaging 1.00
R4518:Dnmt1 UTSW 9 20911978 missense probably benign 0.00
R4586:Dnmt1 UTSW 9 20926693 missense probably benign 0.05
R4836:Dnmt1 UTSW 9 20908558 missense probably damaging 1.00
R5338:Dnmt1 UTSW 9 20952719 missense probably benign 0.44
R5385:Dnmt1 UTSW 9 20918480 missense probably damaging 1.00
R5579:Dnmt1 UTSW 9 20920205 missense probably damaging 1.00
R5645:Dnmt1 UTSW 9 20922147 missense probably damaging 1.00
R5719:Dnmt1 UTSW 9 20912595 missense possibly damaging 0.86
R5881:Dnmt1 UTSW 9 20952717 missense probably damaging 0.97
R6039:Dnmt1 UTSW 9 20926420 intron probably benign
R6039:Dnmt1 UTSW 9 20926420 intron probably benign
R6143:Dnmt1 UTSW 9 20927134 missense probably benign 0.30
R6342:Dnmt1 UTSW 9 20909793 nonsense probably null
R6374:Dnmt1 UTSW 9 20924045 missense possibly damaging 0.73
R6953:Dnmt1 UTSW 9 20918526 missense probably benign
R6990:Dnmt1 UTSW 9 20915814 nonsense probably null
R7089:Dnmt1 UTSW 9 20908489 missense probably damaging 0.99
R7463:Dnmt1 UTSW 9 20912225 missense possibly damaging 0.86
R7522:Dnmt1 UTSW 9 20920202 missense probably damaging 0.99
R7695:Dnmt1 UTSW 9 20913985 missense probably null 1.00
R7785:Dnmt1 UTSW 9 20922049 missense probably damaging 0.98
R8037:Dnmt1 UTSW 9 20941564 missense probably damaging 0.99
R8038:Dnmt1 UTSW 9 20941564 missense probably damaging 0.99
RF003:Dnmt1 UTSW 9 20910131 nonsense probably null
RF004:Dnmt1 UTSW 9 20910127 nonsense probably null
RF011:Dnmt1 UTSW 9 20910128 nonsense probably null
RF011:Dnmt1 UTSW 9 20910144 nonsense probably null
RF015:Dnmt1 UTSW 9 20910124 nonsense probably null
RF015:Dnmt1 UTSW 9 20910129 nonsense probably null
RF017:Dnmt1 UTSW 9 20910126 nonsense probably null
RF023:Dnmt1 UTSW 9 20910131 nonsense probably null
RF024:Dnmt1 UTSW 9 20910130 nonsense probably null
RF024:Dnmt1 UTSW 9 20910138 small insertion probably benign
RF025:Dnmt1 UTSW 9 20910120 nonsense probably null
RF025:Dnmt1 UTSW 9 20910135 nonsense probably null
RF029:Dnmt1 UTSW 9 20910123 nonsense probably null
RF034:Dnmt1 UTSW 9 20910120 nonsense probably null
RF037:Dnmt1 UTSW 9 20910119 critical splice donor site probably benign
RF037:Dnmt1 UTSW 9 20910133 nonsense probably null
RF037:Dnmt1 UTSW 9 20910141 nonsense probably null
RF042:Dnmt1 UTSW 9 20910119 nonsense probably null
RF045:Dnmt1 UTSW 9 20910129 nonsense probably null
RF045:Dnmt1 UTSW 9 20910137 small insertion probably benign
RF047:Dnmt1 UTSW 9 20910125 nonsense probably null
RF048:Dnmt1 UTSW 9 20910126 nonsense probably null
RF054:Dnmt1 UTSW 9 20910139 nonsense probably null
RF055:Dnmt1 UTSW 9 20910128 nonsense probably null
RF055:Dnmt1 UTSW 9 20910135 nonsense probably null
RF055:Dnmt1 UTSW 9 20910136 small insertion probably benign
RF059:Dnmt1 UTSW 9 20910138 small insertion probably benign
RF059:Dnmt1 UTSW 9 20910139 nonsense probably null
RF060:Dnmt1 UTSW 9 20910142 nonsense probably null
RF061:Dnmt1 UTSW 9 20910130 nonsense probably null
X0026:Dnmt1 UTSW 9 20913914 missense probably damaging 1.00
Z1176:Dnmt1 UTSW 9 20915863 missense probably damaging 0.99
Z1176:Dnmt1 UTSW 9 20926554 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTGCTCAAACATGCATCGC -3'
(R):5'- CCTGCCAAATTCTGGGGTCATAG -3'

Sequencing Primer
(F):5'- TGCATCGCACCACTTGACAG -3'
(R):5'- TCATAGACGCCAGCGCTTG -3'
Posted On2016-05-10