Incidental Mutation 'R5014:Slc13a2'
ID385445
Institutional Source Beutler Lab
Gene Symbol Slc13a2
Ensembl Gene ENSMUSG00000001095
Gene Namesolute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2
Synonymssodium/dicarboxylate co-transporter, Nadc1, mNaDC-1
MMRRC Submission 042605-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5014 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location78397087-78422217 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78400161 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 406 (K406E)
Ref Sequence ENSEMBL: ENSMUSP00000001122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001122]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001122
AA Change: K406E

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000001122
Gene: ENSMUSG00000001095
AA Change: K406E

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 6 560 7.1e-161 PFAM
Pfam:CitMHS 45 164 3e-15 PFAM
Pfam:CitMHS 203 499 1.5e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149865
Meta Mutation Damage Score 0.2065 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.7%
Validation Efficiency 97% (83/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a sodium-coupled citrate transporter that is regulated by the chaperone activity of cyclophilin b. The encoded protein may play a role in the formation of kidney stones. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased Kreb cycle intermediates in the urine but otherwise have normal kidney function and response to ischemia-reperfusion injury and caloric restriction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,543,933 T1353A probably benign Het
Abca8b A T 11: 109,950,131 I1072N probably damaging Het
Atp1a2 T C 1: 172,284,871 T517A probably benign Het
Blk T G 14: 63,379,787 N257T probably benign Het
Brd4 A T 17: 32,198,398 probably benign Het
Calr4 C T 4: 109,235,797 Q25* probably null Het
Casc1 T C 6: 145,183,266 E407G probably damaging Het
Cbl T C 9: 44,154,399 probably null Het
Ccdc30 T G 4: 119,393,627 H6P possibly damaging Het
Cd101 A C 3: 101,003,823 Y840D probably damaging Het
Cd68 T A 11: 69,665,339 N178Y probably damaging Het
Cep350 T C 1: 155,928,206 T1044A probably benign Het
Cfap46 A G 7: 139,627,375 V1876A probably benign Het
Clec2g T A 6: 128,948,802 M58K probably benign Het
Clip1 T C 5: 123,617,730 E860G probably damaging Het
Col18a1 C T 10: 77,070,960 probably null Het
Cul7 A G 17: 46,655,942 *650W probably null Het
Dkk4 C T 8: 22,625,299 A55V probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnase1 C A 16: 4,039,016 Y170* probably null Het
Dnmt1 A C 9: 20,912,254 I1019S probably benign Het
Epha6 T A 16: 59,666,579 H1035L probably benign Het
Fam124b T C 1: 80,200,059 T408A probably benign Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fam71f1 C T 6: 29,326,724 probably benign Het
Galnt7 T C 8: 57,545,380 E305G probably damaging Het
Git1 T A 11: 77,498,995 V28E probably damaging Het
Gm10010 C T 6: 128,200,593 noncoding transcript Het
Gm4956 T C 1: 21,293,597 noncoding transcript Het
Gpr152 T G 19: 4,143,507 V349G probably benign Het
Gtsf1l C T 2: 163,087,192 V124I probably damaging Het
Gucy1b1 C G 3: 82,046,667 G114A probably benign Het
Hk2 T C 6: 82,743,955 Q166R possibly damaging Het
Hook2 A G 8: 84,991,377 I44M probably damaging Het
Ildr1 T A 16: 36,721,559 M222K probably damaging Het
Ints6 A T 14: 62,760,191 F55Y probably benign Het
Kcnh1 A G 1: 192,277,080 N314S probably damaging Het
Lpin3 T C 2: 160,904,828 F748L probably damaging Het
Lrsam1 T C 2: 32,936,395 probably benign Het
Msh2 A T 17: 87,717,576 K627N possibly damaging Het
Myrip A G 9: 120,422,468 Q219R probably damaging Het
Ndufb3 T A 1: 58,591,242 W51R probably damaging Het
Nfasc A T 1: 132,584,447 probably benign Het
Olfr15 T A 16: 3,839,048 I25N probably benign Het
Olfr281 T C 15: 98,456,976 V222A possibly damaging Het
Olfr90 T A 17: 37,085,554 I204F probably benign Het
P3h3 T A 6: 124,855,236 E229V probably damaging Het
Ppfia2 T A 10: 106,865,363 L837* probably null Het
Ppp2r1a G A 17: 20,958,839 probably null Het
Rabgap1 T A 2: 37,487,140 V328E probably damaging Het
Ralgapb G A 2: 158,495,535 R1138Q probably damaging Het
Ranbp2 A T 10: 58,464,120 Q498L probably benign Het
Rbx1 T A 15: 81,470,960 C56S probably damaging Het
Rcan2 T C 17: 44,017,813 F45S probably damaging Het
Rgs20 T C 1: 4,910,547 Y185C probably damaging Het
Rorc T G 3: 94,391,153 L315R probably damaging Het
Skiv2l A G 17: 34,847,425 V194A probably benign Het
Slc35g3 T A 11: 69,761,040 K62* probably null Het
Sox30 T C 11: 45,991,909 S589P probably benign Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Ssh2 T A 11: 77,455,276 C1362* probably null Het
Tecta C T 9: 42,373,242 C849Y probably damaging Het
Thbs1 T A 2: 118,120,037 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tyk2 C T 9: 21,115,830 probably null Het
Tyw5 C A 1: 57,406,845 probably benign Het
Vcp T C 4: 42,980,828 T761A probably benign Het
Wdfy4 A T 14: 33,100,940 C1401S probably benign Het
Wiz T C 17: 32,359,366 N391D probably damaging Het
Ylpm1 G A 12: 85,014,749 E475K unknown Het
Zcchc11 T C 4: 108,526,846 probably benign Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp184 A G 13: 21,958,424 D100G probably benign Het
Zfp990 T A 4: 145,538,099 C556S possibly damaging Het
Zkscan16 C T 4: 58,951,892 P189L probably damaging Het
Other mutations in Slc13a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Slc13a2 APN 11 78400548 missense probably damaging 1.00
IGL01604:Slc13a2 APN 11 78403395 missense possibly damaging 0.82
IGL01679:Slc13a2 APN 11 78404711 missense probably damaging 1.00
IGL03100:Slc13a2 APN 11 78404473 missense probably damaging 1.00
IGL03380:Slc13a2 APN 11 78399082 missense probably benign 0.03
deliberate UTSW 11 78403480 critical splice acceptor site probably benign
intentional UTSW 11 78404708 missense probably damaging 1.00
R0085:Slc13a2 UTSW 11 78406868 missense probably damaging 0.96
R0324:Slc13a2 UTSW 11 78404524 missense probably damaging 1.00
R0368:Slc13a2 UTSW 11 78404800 nonsense probably null
R0440:Slc13a2 UTSW 11 78403175 missense probably benign 0.05
R0539:Slc13a2 UTSW 11 78399138 missense probably damaging 1.00
R1519:Slc13a2 UTSW 11 78397746 missense possibly damaging 0.59
R1550:Slc13a2 UTSW 11 78403164 missense probably damaging 1.00
R1909:Slc13a2 UTSW 11 78400142 missense possibly damaging 0.90
R2166:Slc13a2 UTSW 11 78403075 missense probably benign 0.16
R2994:Slc13a2 UTSW 11 78404737 missense probably damaging 1.00
R2998:Slc13a2 UTSW 11 78404785 missense probably damaging 0.99
R3418:Slc13a2 UTSW 11 78400840 missense probably benign 0.05
R3932:Slc13a2 UTSW 11 78398400 missense probably damaging 1.00
R4233:Slc13a2 UTSW 11 78403535 intron probably benign
R4462:Slc13a2 UTSW 11 78404387 missense probably benign 0.44
R5170:Slc13a2 UTSW 11 78400808 missense probably damaging 1.00
R5484:Slc13a2 UTSW 11 78404822 splice site probably benign
R5809:Slc13a2 UTSW 11 78397821 missense probably damaging 1.00
R5973:Slc13a2 UTSW 11 78400532 missense probably damaging 0.99
R6243:Slc13a2 UTSW 11 78404708 missense probably damaging 1.00
R6263:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6275:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6276:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6279:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6280:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6300:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6305:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6314:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6673:Slc13a2 UTSW 11 78397831 missense probably benign 0.12
R7138:Slc13a2 UTSW 11 78399124 missense possibly damaging 0.76
R7382:Slc13a2 UTSW 11 78404795 missense probably damaging 1.00
R7657:Slc13a2 UTSW 11 78398397 missense probably damaging 0.99
R7791:Slc13a2 UTSW 11 78422064 critical splice donor site probably null
R8027:Slc13a2 UTSW 11 78404756 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCATCGCTGAGAGGACTACTC -3'
(R):5'- GGTGACCTGCTAAAGACACAGG -3'

Sequencing Primer
(F):5'- GAGGACTACTCTCCTTTGGGC -3'
(R):5'- CTCAAGGACAGAGTTGGAATCCTAC -3'
Posted On2016-05-10