Incidental Mutation 'R5014:Olfr15'
ID385453
Institutional Source Beutler Lab
Gene Symbol Olfr15
Ensembl Gene ENSMUSG00000059043
Gene Nameolfactory receptor 15
SynonymsOR3, GA_x54KRFPKG5P-348087-349025, MOR256-17
MMRRC Submission 042605-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R5014 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location3830878-3844747 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3839048 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 25 (I25N)
Ref Sequence ENSEMBL: ENSMUSP00000150757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080917] [ENSMUST00000214238] [ENSMUST00000214590]
Predicted Effect probably benign
Transcript: ENSMUST00000080917
AA Change: I25N

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000079720
Gene: ENSMUSG00000059043
AA Change: I25N

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 25 301 2.7e-8 PFAM
Pfam:7tm_4 31 307 1.3e-52 PFAM
Pfam:7tm_1 41 290 9.8e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214238
AA Change: I25N

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000214590
AA Change: I25N

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.7%
Validation Efficiency 97% (83/86)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,543,933 T1353A probably benign Het
Abca8b A T 11: 109,950,131 I1072N probably damaging Het
Atp1a2 T C 1: 172,284,871 T517A probably benign Het
Blk T G 14: 63,379,787 N257T probably benign Het
Brd4 A T 17: 32,198,398 probably benign Het
Calr4 C T 4: 109,235,797 Q25* probably null Het
Casc1 T C 6: 145,183,266 E407G probably damaging Het
Cbl T C 9: 44,154,399 probably null Het
Ccdc30 T G 4: 119,393,627 H6P possibly damaging Het
Cd101 A C 3: 101,003,823 Y840D probably damaging Het
Cd68 T A 11: 69,665,339 N178Y probably damaging Het
Cep350 T C 1: 155,928,206 T1044A probably benign Het
Cfap46 A G 7: 139,627,375 V1876A probably benign Het
Clec2g T A 6: 128,948,802 M58K probably benign Het
Clip1 T C 5: 123,617,730 E860G probably damaging Het
Col18a1 C T 10: 77,070,960 probably null Het
Cul7 A G 17: 46,655,942 *650W probably null Het
Dkk4 C T 8: 22,625,299 A55V probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnase1 C A 16: 4,039,016 Y170* probably null Het
Dnmt1 A C 9: 20,912,254 I1019S probably benign Het
Epha6 T A 16: 59,666,579 H1035L probably benign Het
Fam124b T C 1: 80,200,059 T408A probably benign Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fam71f1 C T 6: 29,326,724 probably benign Het
Galnt7 T C 8: 57,545,380 E305G probably damaging Het
Git1 T A 11: 77,498,995 V28E probably damaging Het
Gm10010 C T 6: 128,200,593 noncoding transcript Het
Gm4956 T C 1: 21,293,597 noncoding transcript Het
Gpr152 T G 19: 4,143,507 V349G probably benign Het
Gtsf1l C T 2: 163,087,192 V124I probably damaging Het
Gucy1b1 C G 3: 82,046,667 G114A probably benign Het
Hk2 T C 6: 82,743,955 Q166R possibly damaging Het
Hook2 A G 8: 84,991,377 I44M probably damaging Het
Ildr1 T A 16: 36,721,559 M222K probably damaging Het
Ints6 A T 14: 62,760,191 F55Y probably benign Het
Kcnh1 A G 1: 192,277,080 N314S probably damaging Het
Lpin3 T C 2: 160,904,828 F748L probably damaging Het
Lrsam1 T C 2: 32,936,395 probably benign Het
Msh2 A T 17: 87,717,576 K627N possibly damaging Het
Myrip A G 9: 120,422,468 Q219R probably damaging Het
Ndufb3 T A 1: 58,591,242 W51R probably damaging Het
Nfasc A T 1: 132,584,447 probably benign Het
Olfr281 T C 15: 98,456,976 V222A possibly damaging Het
Olfr90 T A 17: 37,085,554 I204F probably benign Het
P3h3 T A 6: 124,855,236 E229V probably damaging Het
Ppfia2 T A 10: 106,865,363 L837* probably null Het
Ppp2r1a G A 17: 20,958,839 probably null Het
Rabgap1 T A 2: 37,487,140 V328E probably damaging Het
Ralgapb G A 2: 158,495,535 R1138Q probably damaging Het
Ranbp2 A T 10: 58,464,120 Q498L probably benign Het
Rbx1 T A 15: 81,470,960 C56S probably damaging Het
Rcan2 T C 17: 44,017,813 F45S probably damaging Het
Rgs20 T C 1: 4,910,547 Y185C probably damaging Het
Rorc T G 3: 94,391,153 L315R probably damaging Het
Skiv2l A G 17: 34,847,425 V194A probably benign Het
Slc13a2 T C 11: 78,400,161 K406E possibly damaging Het
Slc35g3 T A 11: 69,761,040 K62* probably null Het
Sox30 T C 11: 45,991,909 S589P probably benign Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Ssh2 T A 11: 77,455,276 C1362* probably null Het
Tecta C T 9: 42,373,242 C849Y probably damaging Het
Thbs1 T A 2: 118,120,037 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tyk2 C T 9: 21,115,830 probably null Het
Tyw5 C A 1: 57,406,845 probably benign Het
Vcp T C 4: 42,980,828 T761A probably benign Het
Wdfy4 A T 14: 33,100,940 C1401S probably benign Het
Wiz T C 17: 32,359,366 N391D probably damaging Het
Ylpm1 G A 12: 85,014,749 E475K unknown Het
Zcchc11 T C 4: 108,526,846 probably benign Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp184 A G 13: 21,958,424 D100G probably benign Het
Zfp990 T A 4: 145,538,099 C556S possibly damaging Het
Zkscan16 C T 4: 58,951,892 P189L probably damaging Het
Other mutations in Olfr15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01973:Olfr15 APN 16 3839777 missense probably damaging 0.99
IGL02444:Olfr15 APN 16 3839687 missense probably damaging 1.00
IGL02516:Olfr15 APN 16 3839336 missense probably damaging 1.00
IGL02941:Olfr15 APN 16 3839816 missense possibly damaging 0.64
PIT4812001:Olfr15 UTSW 16 3839530 nonsense probably null
R0380:Olfr15 UTSW 16 3838985 missense probably benign
R1542:Olfr15 UTSW 16 3839832 missense probably damaging 1.00
R1574:Olfr15 UTSW 16 3839657 missense probably damaging 0.99
R1574:Olfr15 UTSW 16 3839657 missense probably damaging 0.99
R1633:Olfr15 UTSW 16 3839532 missense probably damaging 1.00
R4207:Olfr15 UTSW 16 3839570 missense probably damaging 1.00
R4632:Olfr15 UTSW 16 3839087 missense probably damaging 1.00
R4965:Olfr15 UTSW 16 3839570 missense probably damaging 1.00
R6575:Olfr15 UTSW 16 3839030 missense probably benign 0.00
R7367:Olfr15 UTSW 16 3839302 missense probably damaging 0.99
R7523:Olfr15 UTSW 16 3839699 missense probably benign
R7697:Olfr15 UTSW 16 3839566 missense probably damaging 0.96
R7876:Olfr15 UTSW 16 3838794 splice site probably null
R7959:Olfr15 UTSW 16 3838794 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTGACATCCCAGCTCAACTG -3'
(R):5'- CATCTGAGGGACTGAACTGG -3'

Sequencing Primer
(F):5'- CTTGCATGAAAGCTCGTGGC -3'
(R):5'- CTGAACTGGTAGTAAAGGCAAGGTC -3'
Posted On2016-05-10