Incidental Mutation 'R5014:Epha6'
ID 385456
Institutional Source Beutler Lab
Gene Symbol Epha6
Ensembl Gene ENSMUSG00000055540
Gene Name Eph receptor A6
Synonyms m-ehk2, Hek12, Ehk2
MMRRC Submission 042605-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5014 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 59653483-60605531 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 59666579 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 1035 (H1035L)
Ref Sequence ENSEMBL: ENSMUSP00000066734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068860]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000068860
AA Change: H1035L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000066734
Gene: ENSMUSG00000055540
AA Change: H1035L

DomainStartEndE-ValueType
low complexity region 4 37 N/A INTRINSIC
low complexity region 79 90 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
EPH_lbd 128 301 5.95e-125 SMART
Pfam:GCC2_GCC3 361 406 1.6e-8 PFAM
FN3 426 518 5.83e-3 SMART
FN3 537 618 2.19e-7 SMART
Pfam:EphA2_TM 644 722 1.8e-22 PFAM
TyrKc 725 1024 3.66e-122 SMART
SAM 1052 1119 1.24e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232158
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232302
Meta Mutation Damage Score 0.0589 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.7%
Validation Efficiency 97% (83/86)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display discrete learning and memory deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,543,933 T1353A probably benign Het
Abca8b A T 11: 109,950,131 I1072N probably damaging Het
Atp1a2 T C 1: 172,284,871 T517A probably benign Het
Blk T G 14: 63,379,787 N257T probably benign Het
Brd4 A T 17: 32,198,398 probably benign Het
Calr4 C T 4: 109,235,797 Q25* probably null Het
Casc1 T C 6: 145,183,266 E407G probably damaging Het
Cbl T C 9: 44,154,399 probably null Het
Ccdc30 T G 4: 119,393,627 H6P possibly damaging Het
Cd101 A C 3: 101,003,823 Y840D probably damaging Het
Cd68 T A 11: 69,665,339 N178Y probably damaging Het
Cep350 T C 1: 155,928,206 T1044A probably benign Het
Cfap46 A G 7: 139,627,375 V1876A probably benign Het
Clec2g T A 6: 128,948,802 M58K probably benign Het
Clip1 T C 5: 123,617,730 E860G probably damaging Het
Col18a1 C T 10: 77,070,960 probably null Het
Cul7 A G 17: 46,655,942 *650W probably null Het
Dkk4 C T 8: 22,625,299 A55V probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnase1 C A 16: 4,039,016 Y170* probably null Het
Dnmt1 A C 9: 20,912,254 I1019S probably benign Het
Fam124b T C 1: 80,200,059 T408A probably benign Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fam71f1 C T 6: 29,326,724 probably benign Het
Galnt7 T C 8: 57,545,380 E305G probably damaging Het
Git1 T A 11: 77,498,995 V28E probably damaging Het
Gm10010 C T 6: 128,200,593 noncoding transcript Het
Gm4956 T C 1: 21,293,597 noncoding transcript Het
Gpr152 T G 19: 4,143,507 V349G probably benign Het
Gtsf1l C T 2: 163,087,192 V124I probably damaging Het
Gucy1b1 C G 3: 82,046,667 G114A probably benign Het
Hk2 T C 6: 82,743,955 Q166R possibly damaging Het
Hook2 A G 8: 84,991,377 I44M probably damaging Het
Ildr1 T A 16: 36,721,559 M222K probably damaging Het
Ints6 A T 14: 62,760,191 F55Y probably benign Het
Kcnh1 A G 1: 192,277,080 N314S probably damaging Het
Lpin3 T C 2: 160,904,828 F748L probably damaging Het
Lrsam1 T C 2: 32,936,395 probably benign Het
Msh2 A T 17: 87,717,576 K627N possibly damaging Het
Myrip A G 9: 120,422,468 Q219R probably damaging Het
Ndufb3 T A 1: 58,591,242 W51R probably damaging Het
Nfasc A T 1: 132,584,447 probably benign Het
Olfr15 T A 16: 3,839,048 I25N probably benign Het
Olfr281 T C 15: 98,456,976 V222A possibly damaging Het
Olfr90 T A 17: 37,085,554 I204F probably benign Het
P3h3 T A 6: 124,855,236 E229V probably damaging Het
Ppfia2 T A 10: 106,865,363 L837* probably null Het
Ppp2r1a G A 17: 20,958,839 probably null Het
Rabgap1 T A 2: 37,487,140 V328E probably damaging Het
Ralgapb G A 2: 158,495,535 R1138Q probably damaging Het
Ranbp2 A T 10: 58,464,120 Q498L probably benign Het
Rbx1 T A 15: 81,470,960 C56S probably damaging Het
Rcan2 T C 17: 44,017,813 F45S probably damaging Het
Rgs20 T C 1: 4,910,547 Y185C probably damaging Het
Rorc T G 3: 94,391,153 L315R probably damaging Het
Skiv2l A G 17: 34,847,425 V194A probably benign Het
Slc13a2 T C 11: 78,400,161 K406E possibly damaging Het
Slc35g3 T A 11: 69,761,040 K62* probably null Het
Sox30 T C 11: 45,991,909 S589P probably benign Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Ssh2 T A 11: 77,455,276 C1362* probably null Het
Tecta C T 9: 42,373,242 C849Y probably damaging Het
Thbs1 T A 2: 118,120,037 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tyk2 C T 9: 21,115,830 probably null Het
Tyw5 C A 1: 57,406,845 probably benign Het
Vcp T C 4: 42,980,828 T761A probably benign Het
Wdfy4 A T 14: 33,100,940 C1401S probably benign Het
Wiz T C 17: 32,359,366 N391D probably damaging Het
Ylpm1 G A 12: 85,014,749 E475K unknown Het
Zcchc11 T C 4: 108,526,846 probably benign Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp184 A G 13: 21,958,424 D100G probably benign Het
Zfp990 T A 4: 145,538,099 C556S possibly damaging Het
Zkscan16 C T 4: 58,951,892 P189L probably damaging Het
Other mutations in Epha6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Epha6 APN 16 59915962 missense probably damaging 1.00
IGL00849:Epha6 APN 16 60425111 missense possibly damaging 0.89
IGL00898:Epha6 APN 16 59775541 critical splice donor site probably null
IGL01353:Epha6 APN 16 60424895 missense probably damaging 1.00
IGL01409:Epha6 APN 16 59655737 nonsense probably null
IGL01577:Epha6 APN 16 59956926 missense possibly damaging 0.57
IGL01653:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01654:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01655:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01657:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01663:Epha6 APN 16 59775644 missense probably damaging 1.00
IGL01899:Epha6 APN 16 59839303 missense probably benign 0.05
IGL02272:Epha6 APN 16 59818937 missense probably damaging 1.00
IGL03265:Epha6 APN 16 60060231 splice site probably benign
IGL03333:Epha6 APN 16 59682688 missense probably damaging 1.00
rauwulfia UTSW 16 59682616 missense probably damaging 1.00
PIT4377001:Epha6 UTSW 16 60205552 missense probably damaging 0.98
R0505:Epha6 UTSW 16 60205732 missense possibly damaging 0.89
R1593:Epha6 UTSW 16 60424904 missense probably damaging 1.00
R1764:Epha6 UTSW 16 59775728 missense probably null 1.00
R1836:Epha6 UTSW 16 60205745 missense probably damaging 1.00
R2061:Epha6 UTSW 16 59655797 missense probably damaging 1.00
R2125:Epha6 UTSW 16 59682688 missense probably damaging 1.00
R2867:Epha6 UTSW 16 59960296 splice site probably null
R2867:Epha6 UTSW 16 59960296 splice site probably null
R3760:Epha6 UTSW 16 60220984 missense possibly damaging 0.70
R4305:Epha6 UTSW 16 60526520 splice site probably null
R4613:Epha6 UTSW 16 59666597 missense possibly damaging 0.80
R4818:Epha6 UTSW 16 59654063 missense probably damaging 0.99
R4832:Epha6 UTSW 16 59960413 missense probably damaging 0.98
R4895:Epha6 UTSW 16 59666555 missense probably benign 0.08
R5316:Epha6 UTSW 16 59954720 missense probably damaging 0.99
R5403:Epha6 UTSW 16 59775570 missense probably damaging 1.00
R5417:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R5418:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R5678:Epha6 UTSW 16 59818979 missense probably damaging 1.00
R5775:Epha6 UTSW 16 59818994 missense possibly damaging 0.92
R5808:Epha6 UTSW 16 59682742 missense probably damaging 1.00
R6076:Epha6 UTSW 16 60205710 missense probably damaging 1.00
R6146:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6212:Epha6 UTSW 16 60425356 missense possibly damaging 0.77
R6242:Epha6 UTSW 16 59682662 missense probably damaging 1.00
R6503:Epha6 UTSW 16 60205621 missense possibly damaging 0.61
R6580:Epha6 UTSW 16 59682616 missense probably damaging 1.00
R6726:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6728:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6798:Epha6 UTSW 16 60605064 missense possibly damaging 0.53
R6798:Epha6 UTSW 16 60605065 missense possibly damaging 0.53
R6903:Epha6 UTSW 16 60526462 missense probably benign 0.00
R6999:Epha6 UTSW 16 60425170 missense possibly damaging 0.94
R7058:Epha6 UTSW 16 59682650 missense probably damaging 1.00
R7109:Epha6 UTSW 16 59682668 missense probably damaging 1.00
R7263:Epha6 UTSW 16 59775665 missense probably damaging 1.00
R7296:Epha6 UTSW 16 59915838 missense probably benign 0.00
R7343:Epha6 UTSW 16 59960430 missense probably damaging 0.98
R7443:Epha6 UTSW 16 59775625 missense possibly damaging 0.93
R7533:Epha6 UTSW 16 60205562 missense probably damaging 1.00
R7602:Epha6 UTSW 16 59775568 missense probably damaging 1.00
R7604:Epha6 UTSW 16 60205772 missense possibly damaging 0.89
R8321:Epha6 UTSW 16 59915954 missense probably damaging 1.00
R8414:Epha6 UTSW 16 60005667 missense probably damaging 1.00
R8794:Epha6 UTSW 16 60205672 missense probably benign 0.00
R8926:Epha6 UTSW 16 59839299 missense probably benign 0.11
R9166:Epha6 UTSW 16 60604875 missense probably benign 0.00
R9265:Epha6 UTSW 16 59655754 missense probably damaging 1.00
R9322:Epha6 UTSW 16 60424755 missense probably damaging 1.00
R9442:Epha6 UTSW 16 60205487 missense probably benign 0.26
R9742:Epha6 UTSW 16 60205702 missense probably damaging 1.00
Z1188:Epha6 UTSW 16 59654090 missense probably damaging 1.00
Z1189:Epha6 UTSW 16 59654090 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTGCTTGCCATTTCAAATAG -3'
(R):5'- GTAAGAGCGTGATCTGCGTG -3'

Sequencing Primer
(F):5'- TTGAAGAGGACACACACATGAACAC -3'
(R):5'- TGTTTGCATTTAGGTTATCTTGTCC -3'
Posted On 2016-05-10