Incidental Mutation 'R5014:Brd4'
ID385458
Institutional Source Beutler Lab
Gene Symbol Brd4
Ensembl Gene ENSMUSG00000024002
Gene Namebromodomain containing 4
SynonymsHUNK1, MCAP, WI-11513
MMRRC Submission 042605-MU
Accession Numbers

Genbank: NM_020508.3; NM_198094.2; MGI: 1888520

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5014 (G1)
Quality Score147
Status Validated
Chromosome17
Chromosomal Location32196274-32284722 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 32198398 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003726] [ENSMUST00000119123] [ENSMUST00000121285] [ENSMUST00000230858]
Predicted Effect unknown
Transcript: ENSMUST00000003726
AA Change: H1284Q
SMART Domains Protein: ENSMUSP00000003726
Gene: ENSMUSG00000024002
AA Change: H1284Q

DomainStartEndE-ValueType
low complexity region 23 54 N/A INTRINSIC
BROMO 56 166 1e-52 SMART
low complexity region 176 191 N/A INTRINSIC
low complexity region 198 224 N/A INTRINSIC
low complexity region 237 275 N/A INTRINSIC
low complexity region 295 305 N/A INTRINSIC
low complexity region 329 339 N/A INTRINSIC
BROMO 352 461 1.2e-48 SMART
coiled coil region 504 570 N/A INTRINSIC
Pfam:BET 611 675 6.4e-33 PFAM
low complexity region 701 722 N/A INTRINSIC
low complexity region 746 796 N/A INTRINSIC
low complexity region 828 854 N/A INTRINSIC
low complexity region 890 926 N/A INTRINSIC
low complexity region 929 939 N/A INTRINSIC
low complexity region 953 1005 N/A INTRINSIC
low complexity region 1013 1042 N/A INTRINSIC
low complexity region 1086 1100 N/A INTRINSIC
low complexity region 1105 1120 N/A INTRINSIC
low complexity region 1135 1147 N/A INTRINSIC
low complexity region 1201 1212 N/A INTRINSIC
low complexity region 1248 1260 N/A INTRINSIC
coiled coil region 1261 1345 N/A INTRINSIC
Pfam:BRD4_CDT 1358 1400 3.8e-24 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000119123
AA Change: H1283Q
SMART Domains Protein: ENSMUSP00000113197
Gene: ENSMUSG00000024002
AA Change: H1283Q

DomainStartEndE-ValueType
low complexity region 23 54 N/A INTRINSIC
BROMO 56 166 1.67e-50 SMART
low complexity region 197 223 N/A INTRINSIC
low complexity region 236 274 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
BROMO 351 460 1.81e-46 SMART
coiled coil region 503 569 N/A INTRINSIC
PDB:2JNS|A 606 683 6e-46 PDB
low complexity region 700 721 N/A INTRINSIC
low complexity region 745 795 N/A INTRINSIC
low complexity region 827 853 N/A INTRINSIC
low complexity region 889 925 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 952 1004 N/A INTRINSIC
low complexity region 1012 1041 N/A INTRINSIC
low complexity region 1085 1099 N/A INTRINSIC
low complexity region 1104 1119 N/A INTRINSIC
low complexity region 1134 1146 N/A INTRINSIC
low complexity region 1200 1211 N/A INTRINSIC
low complexity region 1247 1259 N/A INTRINSIC
coiled coil region 1260 1344 N/A INTRINSIC
low complexity region 1361 1381 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000121285
AA Change: H1283Q
SMART Domains Protein: ENSMUSP00000113070
Gene: ENSMUSG00000024002
AA Change: H1283Q

DomainStartEndE-ValueType
low complexity region 23 54 N/A INTRINSIC
BROMO 56 166 1.67e-50 SMART
low complexity region 197 223 N/A INTRINSIC
low complexity region 236 274 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
BROMO 351 460 1.81e-46 SMART
coiled coil region 503 569 N/A INTRINSIC
PDB:2JNS|A 606 683 6e-46 PDB
low complexity region 700 721 N/A INTRINSIC
low complexity region 745 795 N/A INTRINSIC
low complexity region 827 853 N/A INTRINSIC
low complexity region 889 925 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 952 1004 N/A INTRINSIC
low complexity region 1012 1041 N/A INTRINSIC
low complexity region 1085 1099 N/A INTRINSIC
low complexity region 1104 1119 N/A INTRINSIC
low complexity region 1134 1146 N/A INTRINSIC
low complexity region 1200 1211 N/A INTRINSIC
low complexity region 1247 1259 N/A INTRINSIC
coiled coil region 1260 1344 N/A INTRINSIC
low complexity region 1361 1381 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230565
Predicted Effect probably benign
Transcript: ENSMUST00000230858
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.7%
Validation Efficiency 97% (83/86)
MGI Phenotype Strain: 2674141
Lethality: E3-E8
FUNCTION: This gene was temporarily named bromodomain-containing 5 (Brd5) and was renamed bromodomain-containing 4 (Brd4). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a gene-trap null mutation die soon after implantation. Heterozygotes exhibit impaired pre- and postnatal growth, head malformations, lack of subcutaneous fat, cataracts, and abnormal liver cells. [provided by MGI curators]
Allele List at MGI

All alleles(161) : Targeted(1) Gene trapped(160)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,543,933 T1353A probably benign Het
Abca8b A T 11: 109,950,131 I1072N probably damaging Het
Atp1a2 T C 1: 172,284,871 T517A probably benign Het
Blk T G 14: 63,379,787 N257T probably benign Het
Calr4 C T 4: 109,235,797 Q25* probably null Het
Casc1 T C 6: 145,183,266 E407G probably damaging Het
Cbl T C 9: 44,154,399 probably null Het
Ccdc30 T G 4: 119,393,627 H6P possibly damaging Het
Cd101 A C 3: 101,003,823 Y840D probably damaging Het
Cd68 T A 11: 69,665,339 N178Y probably damaging Het
Cep350 T C 1: 155,928,206 T1044A probably benign Het
Cfap46 A G 7: 139,627,375 V1876A probably benign Het
Clec2g T A 6: 128,948,802 M58K probably benign Het
Clip1 T C 5: 123,617,730 E860G probably damaging Het
Col18a1 C T 10: 77,070,960 probably null Het
Cul7 A G 17: 46,655,942 *650W probably null Het
Dkk4 C T 8: 22,625,299 A55V probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnase1 C A 16: 4,039,016 Y170* probably null Het
Dnmt1 A C 9: 20,912,254 I1019S probably benign Het
Epha6 T A 16: 59,666,579 H1035L probably benign Het
Fam124b T C 1: 80,200,059 T408A probably benign Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fam71f1 C T 6: 29,326,724 probably benign Het
Galnt7 T C 8: 57,545,380 E305G probably damaging Het
Git1 T A 11: 77,498,995 V28E probably damaging Het
Gm10010 C T 6: 128,200,593 noncoding transcript Het
Gm4956 T C 1: 21,293,597 noncoding transcript Het
Gpr152 T G 19: 4,143,507 V349G probably benign Het
Gtsf1l C T 2: 163,087,192 V124I probably damaging Het
Gucy1b1 C G 3: 82,046,667 G114A probably benign Het
Hk2 T C 6: 82,743,955 Q166R possibly damaging Het
Hook2 A G 8: 84,991,377 I44M probably damaging Het
Ildr1 T A 16: 36,721,559 M222K probably damaging Het
Ints6 A T 14: 62,760,191 F55Y probably benign Het
Kcnh1 A G 1: 192,277,080 N314S probably damaging Het
Lpin3 T C 2: 160,904,828 F748L probably damaging Het
Lrsam1 T C 2: 32,936,395 probably benign Het
Msh2 A T 17: 87,717,576 K627N possibly damaging Het
Myrip A G 9: 120,422,468 Q219R probably damaging Het
Ndufb3 T A 1: 58,591,242 W51R probably damaging Het
Nfasc A T 1: 132,584,447 probably benign Het
Olfr15 T A 16: 3,839,048 I25N probably benign Het
Olfr281 T C 15: 98,456,976 V222A possibly damaging Het
Olfr90 T A 17: 37,085,554 I204F probably benign Het
P3h3 T A 6: 124,855,236 E229V probably damaging Het
Ppfia2 T A 10: 106,865,363 L837* probably null Het
Ppp2r1a G A 17: 20,958,839 probably null Het
Rabgap1 T A 2: 37,487,140 V328E probably damaging Het
Ralgapb G A 2: 158,495,535 R1138Q probably damaging Het
Ranbp2 A T 10: 58,464,120 Q498L probably benign Het
Rbx1 T A 15: 81,470,960 C56S probably damaging Het
Rcan2 T C 17: 44,017,813 F45S probably damaging Het
Rgs20 T C 1: 4,910,547 Y185C probably damaging Het
Rorc T G 3: 94,391,153 L315R probably damaging Het
Skiv2l A G 17: 34,847,425 V194A probably benign Het
Slc13a2 T C 11: 78,400,161 K406E possibly damaging Het
Slc35g3 T A 11: 69,761,040 K62* probably null Het
Sox30 T C 11: 45,991,909 S589P probably benign Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Ssh2 T A 11: 77,455,276 C1362* probably null Het
Tecta C T 9: 42,373,242 C849Y probably damaging Het
Thbs1 T A 2: 118,120,037 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tyk2 C T 9: 21,115,830 probably null Het
Tyw5 C A 1: 57,406,845 probably benign Het
Vcp T C 4: 42,980,828 T761A probably benign Het
Wdfy4 A T 14: 33,100,940 C1401S probably benign Het
Wiz T C 17: 32,359,366 N391D probably damaging Het
Ylpm1 G A 12: 85,014,749 E475K unknown Het
Zcchc11 T C 4: 108,526,846 probably benign Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp184 A G 13: 21,958,424 D100G probably benign Het
Zfp990 T A 4: 145,538,099 C556S possibly damaging Het
Zkscan16 C T 4: 58,951,892 P189L probably damaging Het
Other mutations in Brd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01736:Brd4 APN 17 32198675 splice site probably benign
IGL01758:Brd4 APN 17 32212829 unclassified probably benign
IGL02750:Brd4 APN 17 32198379 unclassified probably benign
IGL03066:Brd4 APN 17 32199088 intron probably benign
IGL03338:Brd4 APN 17 32213072 missense probably damaging 1.00
Admirable UTSW 17 32225583 missense unknown
H8562:Brd4 UTSW 17 32229403 splice site probably benign
P0035:Brd4 UTSW 17 32212838 critical splice donor site probably null
R0243:Brd4 UTSW 17 32224123 missense probably benign 0.15
R0281:Brd4 UTSW 17 32213540 unclassified probably benign
R0331:Brd4 UTSW 17 32202515 missense probably benign 0.01
R0722:Brd4 UTSW 17 32212982 missense possibly damaging 0.76
R0750:Brd4 UTSW 17 32220252 missense probably benign 0.09
R1544:Brd4 UTSW 17 32198672 splice site probably benign
R1920:Brd4 UTSW 17 32198086 unclassified probably benign
R1922:Brd4 UTSW 17 32198086 unclassified probably benign
R1957:Brd4 UTSW 17 32221366 missense possibly damaging 0.50
R2240:Brd4 UTSW 17 32213639 unclassified probably benign
R2316:Brd4 UTSW 17 32212910 missense probably benign 0.03
R2333:Brd4 UTSW 17 32221457 missense probably damaging 0.97
R3809:Brd4 UTSW 17 32211270 missense possibly damaging 0.72
R4273:Brd4 UTSW 17 32214782 missense probably benign
R4595:Brd4 UTSW 17 32198922 missense probably damaging 0.97
R4854:Brd4 UTSW 17 32220237 missense probably damaging 0.96
R4923:Brd4 UTSW 17 32199240 missense probably benign 0.38
R5757:Brd4 UTSW 17 32201298 unclassified probably benign
R5979:Brd4 UTSW 17 32198726 missense probably benign 0.32
R6212:Brd4 UTSW 17 32202449 missense probably damaging 0.98
R6394:Brd4 UTSW 17 32224147 nonsense probably null
R6643:Brd4 UTSW 17 32198496 missense unknown
R7024:Brd4 UTSW 17 32221910 utr 3 prime probably benign
R7033:Brd4 UTSW 17 32199015 missense probably benign 0.13
R7220:Brd4 UTSW 17 32225583 missense unknown
R7682:Brd4 UTSW 17 32201160 missense unknown
R7731:Brd4 UTSW 17 32211224 missense possibly damaging 0.73
R7732:Brd4 UTSW 17 32221412 missense unknown
R7750:Brd4 UTSW 17 32213547 missense unknown
R7756:Brd4 UTSW 17 32198982 missense unknown
R7758:Brd4 UTSW 17 32198982 missense unknown
R7779:Brd4 UTSW 17 32212936 missense probably benign 0.03
X0064:Brd4 UTSW 17 32201127 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGAATCTCCACGGTAGACTCCC -3'
(R):5'- TGACATACCCTGTGCAGCAG -3'

Sequencing Primer
(F):5'- TGGTCCAGCATAGACTGGG -3'
(R):5'- GACCTTTGCCTATATAGGACCTG -3'
Posted On2016-05-10