Incidental Mutation 'R5014:Olfr90'
ID385461
Institutional Source Beutler Lab
Gene Symbol Olfr90
Ensembl Gene ENSMUSG00000056600
Gene Nameolfactory receptor 90
SynonymsMOR256-21, GA_x6K02T2PSCP-1526227-1525295
MMRRC Submission 042605-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R5014 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location37083871-37088499 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37085554 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 204 (I204F)
Ref Sequence ENSEMBL: ENSMUSP00000150119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070808] [ENSMUST00000207101] [ENSMUST00000215195] [ENSMUST00000216488] [ENSMUST00000217397]
Predicted Effect probably benign
Transcript: ENSMUST00000070808
AA Change: I204F

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000065322
Gene: ENSMUSG00000056600
AA Change: I204F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srbc 21 157 9e-8 PFAM
Pfam:7tm_4 29 306 5.3e-52 PFAM
Pfam:7tm_1 39 288 6.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207101
Predicted Effect probably benign
Transcript: ENSMUST00000215195
AA Change: I204F

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215502
Predicted Effect probably benign
Transcript: ENSMUST00000216488
AA Change: I204F

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000217397
AA Change: I204F

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Meta Mutation Damage Score 0.0803 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.7%
Validation Efficiency 97% (83/86)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,543,933 T1353A probably benign Het
Abca8b A T 11: 109,950,131 I1072N probably damaging Het
Atp1a2 T C 1: 172,284,871 T517A probably benign Het
Blk T G 14: 63,379,787 N257T probably benign Het
Brd4 A T 17: 32,198,398 probably benign Het
Calr4 C T 4: 109,235,797 Q25* probably null Het
Casc1 T C 6: 145,183,266 E407G probably damaging Het
Cbl T C 9: 44,154,399 probably null Het
Ccdc30 T G 4: 119,393,627 H6P possibly damaging Het
Cd101 A C 3: 101,003,823 Y840D probably damaging Het
Cd68 T A 11: 69,665,339 N178Y probably damaging Het
Cep350 T C 1: 155,928,206 T1044A probably benign Het
Cfap46 A G 7: 139,627,375 V1876A probably benign Het
Clec2g T A 6: 128,948,802 M58K probably benign Het
Clip1 T C 5: 123,617,730 E860G probably damaging Het
Col18a1 C T 10: 77,070,960 probably null Het
Cul7 A G 17: 46,655,942 *650W probably null Het
Dkk4 C T 8: 22,625,299 A55V probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnase1 C A 16: 4,039,016 Y170* probably null Het
Dnmt1 A C 9: 20,912,254 I1019S probably benign Het
Epha6 T A 16: 59,666,579 H1035L probably benign Het
Fam124b T C 1: 80,200,059 T408A probably benign Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fam71f1 C T 6: 29,326,724 probably benign Het
Galnt7 T C 8: 57,545,380 E305G probably damaging Het
Git1 T A 11: 77,498,995 V28E probably damaging Het
Gm10010 C T 6: 128,200,593 noncoding transcript Het
Gm4956 T C 1: 21,293,597 noncoding transcript Het
Gpr152 T G 19: 4,143,507 V349G probably benign Het
Gtsf1l C T 2: 163,087,192 V124I probably damaging Het
Gucy1b1 C G 3: 82,046,667 G114A probably benign Het
Hk2 T C 6: 82,743,955 Q166R possibly damaging Het
Hook2 A G 8: 84,991,377 I44M probably damaging Het
Ildr1 T A 16: 36,721,559 M222K probably damaging Het
Ints6 A T 14: 62,760,191 F55Y probably benign Het
Kcnh1 A G 1: 192,277,080 N314S probably damaging Het
Lpin3 T C 2: 160,904,828 F748L probably damaging Het
Lrsam1 T C 2: 32,936,395 probably benign Het
Msh2 A T 17: 87,717,576 K627N possibly damaging Het
Myrip A G 9: 120,422,468 Q219R probably damaging Het
Ndufb3 T A 1: 58,591,242 W51R probably damaging Het
Nfasc A T 1: 132,584,447 probably benign Het
Olfr15 T A 16: 3,839,048 I25N probably benign Het
Olfr281 T C 15: 98,456,976 V222A possibly damaging Het
P3h3 T A 6: 124,855,236 E229V probably damaging Het
Ppfia2 T A 10: 106,865,363 L837* probably null Het
Ppp2r1a G A 17: 20,958,839 probably null Het
Rabgap1 T A 2: 37,487,140 V328E probably damaging Het
Ralgapb G A 2: 158,495,535 R1138Q probably damaging Het
Ranbp2 A T 10: 58,464,120 Q498L probably benign Het
Rbx1 T A 15: 81,470,960 C56S probably damaging Het
Rcan2 T C 17: 44,017,813 F45S probably damaging Het
Rgs20 T C 1: 4,910,547 Y185C probably damaging Het
Rorc T G 3: 94,391,153 L315R probably damaging Het
Skiv2l A G 17: 34,847,425 V194A probably benign Het
Slc13a2 T C 11: 78,400,161 K406E possibly damaging Het
Slc35g3 T A 11: 69,761,040 K62* probably null Het
Sox30 T C 11: 45,991,909 S589P probably benign Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Ssh2 T A 11: 77,455,276 C1362* probably null Het
Tecta C T 9: 42,373,242 C849Y probably damaging Het
Thbs1 T A 2: 118,120,037 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tyk2 C T 9: 21,115,830 probably null Het
Tyw5 C A 1: 57,406,845 probably benign Het
Vcp T C 4: 42,980,828 T761A probably benign Het
Wdfy4 A T 14: 33,100,940 C1401S probably benign Het
Wiz T C 17: 32,359,366 N391D probably damaging Het
Ylpm1 G A 12: 85,014,749 E475K unknown Het
Zcchc11 T C 4: 108,526,846 probably benign Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp184 A G 13: 21,958,424 D100G probably benign Het
Zfp990 T A 4: 145,538,099 C556S possibly damaging Het
Zkscan16 C T 4: 58,951,892 P189L probably damaging Het
Other mutations in Olfr90
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01628:Olfr90 APN 17 37085300 nonsense probably null
IGL01893:Olfr90 APN 17 37085868 missense probably damaging 0.99
IGL02036:Olfr90 APN 17 37085667 missense probably damaging 1.00
IGL02851:Olfr90 APN 17 37086156 unclassified probably null
R1701:Olfr90 UTSW 17 37085731 missense probably benign 0.17
R1934:Olfr90 UTSW 17 37086014 missense possibly damaging 0.69
R3773:Olfr90 UTSW 17 37086065 nonsense probably null
R4570:Olfr90 UTSW 17 37085579 missense probably damaging 1.00
R4571:Olfr90 UTSW 17 37085579 missense probably damaging 1.00
R4888:Olfr90 UTSW 17 37085451 missense probably damaging 1.00
R4914:Olfr90 UTSW 17 37085991 missense probably damaging 1.00
R6381:Olfr90 UTSW 17 37086085 missense probably benign 0.00
R7163:Olfr90 UTSW 17 37086045 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGGAGTTCCCACAGCATAG -3'
(R):5'- GATTGGCCTAGTGGAGTCAG -3'

Sequencing Primer
(F):5'- CTCTCTCGAGCATAAGGATTCTTGG -3'
(R):5'- GAGTCAGTAGTTCAGACGCCATC -3'
Posted On2016-05-10