Incidental Mutation 'R5014:Cul7'
ID385463
Institutional Source Beutler Lab
Gene Symbol Cul7
Ensembl Gene ENSMUSG00000038545
Gene Namecullin 7
Synonymsp185, 2510004L20Rik, C230011P08Rik, p193
MMRRC Submission 042605-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5014 (G1)
Quality Score200
Status Validated
Chromosome17
Chromosomal Location46650337-46664364 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 46655942 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 650 (*650W)
Ref Sequence ENSEMBL: ENSMUSP00000116133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043464] [ENSMUST00000133393] [ENSMUST00000145567]
Predicted Effect probably damaging
Transcript: ENSMUST00000043464
AA Change: D700G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000049128
Gene: ENSMUSG00000038545
AA Change: D700G

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 218 229 N/A INTRINSIC
low complexity region 315 324 N/A INTRINSIC
Pfam:Cul7 349 423 5.7e-34 PFAM
low complexity region 462 476 N/A INTRINSIC
low complexity region 603 618 N/A INTRINSIC
low complexity region 635 648 N/A INTRINSIC
APC10 811 973 9.35e-49 SMART
low complexity region 983 993 N/A INTRINSIC
low complexity region 1063 1074 N/A INTRINSIC
low complexity region 1301 1318 N/A INTRINSIC
low complexity region 1335 1370 N/A INTRINSIC
Blast:Cullin_Nedd8 1550 1633 1e-41 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132790
Predicted Effect probably damaging
Transcript: ENSMUST00000133393
AA Change: D402G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119393
Gene: ENSMUSG00000038545
AA Change: D402G

DomainStartEndE-ValueType
low complexity region 17 26 N/A INTRINSIC
Pfam:Cul7 51 126 8e-34 PFAM
low complexity region 164 178 N/A INTRINSIC
low complexity region 305 320 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
SCOP:d1gqpa_ 487 568 1e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144966
Predicted Effect probably null
Transcript: ENSMUST00000145567
AA Change: *650W
SMART Domains Protein: ENSMUSP00000116133
Gene: ENSMUSG00000038545
AA Change: *650W

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
SCOP:d1jdha_ 63 222 2e-4 SMART
low complexity region 315 324 N/A INTRINSIC
Pfam:Cul7 349 424 9.5e-34 PFAM
low complexity region 462 476 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.7%
Validation Efficiency 97% (83/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of an E3 ubiquitin-protein ligase complex. The encoded protein interacts with TP53, CUL9, and FBXW8 proteins. Defects in this gene are a cause of 3M syndrome type 1 (3M1). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
PHENOTYPE: During late gestation, homozygous null fetuses display reduced growth associated with abnormal placental development and hemorrhaging due to vascular defects. Mutant mice are born but die shortly after birth, succumbing to respiratory distress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,543,933 T1353A probably benign Het
Abca8b A T 11: 109,950,131 I1072N probably damaging Het
Atp1a2 T C 1: 172,284,871 T517A probably benign Het
Blk T G 14: 63,379,787 N257T probably benign Het
Brd4 A T 17: 32,198,398 probably benign Het
Calr4 C T 4: 109,235,797 Q25* probably null Het
Casc1 T C 6: 145,183,266 E407G probably damaging Het
Cbl T C 9: 44,154,399 probably null Het
Ccdc30 T G 4: 119,393,627 H6P possibly damaging Het
Cd101 A C 3: 101,003,823 Y840D probably damaging Het
Cd68 T A 11: 69,665,339 N178Y probably damaging Het
Cep350 T C 1: 155,928,206 T1044A probably benign Het
Cfap46 A G 7: 139,627,375 V1876A probably benign Het
Clec2g T A 6: 128,948,802 M58K probably benign Het
Clip1 T C 5: 123,617,730 E860G probably damaging Het
Col18a1 C T 10: 77,070,960 probably null Het
Dkk4 C T 8: 22,625,299 A55V probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnase1 C A 16: 4,039,016 Y170* probably null Het
Dnmt1 A C 9: 20,912,254 I1019S probably benign Het
Epha6 T A 16: 59,666,579 H1035L probably benign Het
Fam124b T C 1: 80,200,059 T408A probably benign Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fam71f1 C T 6: 29,326,724 probably benign Het
Galnt7 T C 8: 57,545,380 E305G probably damaging Het
Git1 T A 11: 77,498,995 V28E probably damaging Het
Gm10010 C T 6: 128,200,593 noncoding transcript Het
Gm4956 T C 1: 21,293,597 noncoding transcript Het
Gpr152 T G 19: 4,143,507 V349G probably benign Het
Gtsf1l C T 2: 163,087,192 V124I probably damaging Het
Gucy1b1 C G 3: 82,046,667 G114A probably benign Het
Hk2 T C 6: 82,743,955 Q166R possibly damaging Het
Hook2 A G 8: 84,991,377 I44M probably damaging Het
Ildr1 T A 16: 36,721,559 M222K probably damaging Het
Ints6 A T 14: 62,760,191 F55Y probably benign Het
Kcnh1 A G 1: 192,277,080 N314S probably damaging Het
Lpin3 T C 2: 160,904,828 F748L probably damaging Het
Lrsam1 T C 2: 32,936,395 probably benign Het
Msh2 A T 17: 87,717,576 K627N possibly damaging Het
Myrip A G 9: 120,422,468 Q219R probably damaging Het
Ndufb3 T A 1: 58,591,242 W51R probably damaging Het
Nfasc A T 1: 132,584,447 probably benign Het
Olfr15 T A 16: 3,839,048 I25N probably benign Het
Olfr281 T C 15: 98,456,976 V222A possibly damaging Het
Olfr90 T A 17: 37,085,554 I204F probably benign Het
P3h3 T A 6: 124,855,236 E229V probably damaging Het
Ppfia2 T A 10: 106,865,363 L837* probably null Het
Ppp2r1a G A 17: 20,958,839 probably null Het
Rabgap1 T A 2: 37,487,140 V328E probably damaging Het
Ralgapb G A 2: 158,495,535 R1138Q probably damaging Het
Ranbp2 A T 10: 58,464,120 Q498L probably benign Het
Rbx1 T A 15: 81,470,960 C56S probably damaging Het
Rcan2 T C 17: 44,017,813 F45S probably damaging Het
Rgs20 T C 1: 4,910,547 Y185C probably damaging Het
Rorc T G 3: 94,391,153 L315R probably damaging Het
Skiv2l A G 17: 34,847,425 V194A probably benign Het
Slc13a2 T C 11: 78,400,161 K406E possibly damaging Het
Slc35g3 T A 11: 69,761,040 K62* probably null Het
Sox30 T C 11: 45,991,909 S589P probably benign Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Ssh2 T A 11: 77,455,276 C1362* probably null Het
Tecta C T 9: 42,373,242 C849Y probably damaging Het
Thbs1 T A 2: 118,120,037 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tyk2 C T 9: 21,115,830 probably null Het
Tyw5 C A 1: 57,406,845 probably benign Het
Vcp T C 4: 42,980,828 T761A probably benign Het
Wdfy4 A T 14: 33,100,940 C1401S probably benign Het
Wiz T C 17: 32,359,366 N391D probably damaging Het
Ylpm1 G A 12: 85,014,749 E475K unknown Het
Zcchc11 T C 4: 108,526,846 probably benign Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp184 A G 13: 21,958,424 D100G probably benign Het
Zfp990 T A 4: 145,538,099 C556S possibly damaging Het
Zkscan16 C T 4: 58,951,892 P189L probably damaging Het
Other mutations in Cul7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Cul7 APN 17 46652508 missense probably damaging 1.00
IGL01288:Cul7 APN 17 46657807 splice site probably benign
IGL01669:Cul7 APN 17 46658715 missense possibly damaging 0.94
P0019:Cul7 UTSW 17 46660247 splice site probably benign
PIT4453001:Cul7 UTSW 17 46651820 missense probably damaging 0.99
R0083:Cul7 UTSW 17 46655556 missense probably benign 0.00
R0121:Cul7 UTSW 17 46663373 missense probably damaging 1.00
R0157:Cul7 UTSW 17 46653835 missense possibly damaging 0.93
R0266:Cul7 UTSW 17 46654595 missense probably benign 0.00
R0358:Cul7 UTSW 17 46663744 critical splice donor site probably null
R0544:Cul7 UTSW 17 46663544 missense possibly damaging 0.94
R0565:Cul7 UTSW 17 46652003 missense probably damaging 0.98
R0677:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R0696:Cul7 UTSW 17 46659608 missense probably damaging 1.00
R0702:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R0735:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R0893:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R0900:Cul7 UTSW 17 46658337 missense probably benign 0.36
R0975:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R0976:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1014:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1016:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1104:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1162:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1378:Cul7 UTSW 17 46662126 missense probably damaging 0.99
R1479:Cul7 UTSW 17 46651747 missense probably damaging 1.00
R1498:Cul7 UTSW 17 46655710 missense probably benign 0.01
R1521:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1542:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1545:Cul7 UTSW 17 46651553 missense probably damaging 1.00
R1598:Cul7 UTSW 17 46663091 missense probably benign 0.10
R1600:Cul7 UTSW 17 46651822 nonsense probably null
R1618:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1752:Cul7 UTSW 17 46653167 missense probably benign 0.10
R1881:Cul7 UTSW 17 46651962 missense probably damaging 1.00
R1901:Cul7 UTSW 17 46655740 missense probably damaging 1.00
R1902:Cul7 UTSW 17 46655740 missense probably damaging 1.00
R1913:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R2213:Cul7 UTSW 17 46651472 missense probably damaging 0.99
R2370:Cul7 UTSW 17 46661641 missense probably damaging 1.00
R2929:Cul7 UTSW 17 46651600 missense probably benign 0.00
R2930:Cul7 UTSW 17 46651600 missense probably benign 0.00
R2990:Cul7 UTSW 17 46651600 missense probably benign 0.00
R2992:Cul7 UTSW 17 46651600 missense probably benign 0.00
R4201:Cul7 UTSW 17 46661312 missense probably damaging 1.00
R4792:Cul7 UTSW 17 46657050 nonsense probably null
R4971:Cul7 UTSW 17 46659119 missense probably benign 0.00
R5384:Cul7 UTSW 17 46654477 missense probably benign 0.44
R5957:Cul7 UTSW 17 46657757 missense probably damaging 1.00
R6128:Cul7 UTSW 17 46651662 missense probably damaging 1.00
R6294:Cul7 UTSW 17 46663148 missense probably benign
R6812:Cul7 UTSW 17 46661409 missense probably benign 0.00
R7073:Cul7 UTSW 17 46658731 missense probably damaging 1.00
R7112:Cul7 UTSW 17 46651698 missense probably damaging 1.00
R7246:Cul7 UTSW 17 46662067 missense probably benign 0.04
R7361:Cul7 UTSW 17 46657007 missense probably damaging 1.00
R7567:Cul7 UTSW 17 46654595 missense probably benign 0.00
R7682:Cul7 UTSW 17 46655595 missense probably benign
R7689:Cul7 UTSW 17 46652821 nonsense probably null
R7797:Cul7 UTSW 17 46658642 missense possibly damaging 0.65
R7897:Cul7 UTSW 17 46658005 missense probably benign
R7980:Cul7 UTSW 17 46658005 missense probably benign
Z1177:Cul7 UTSW 17 46652805 frame shift probably null
Z1177:Cul7 UTSW 17 46658738 missense probably damaging 0.99
Z1177:Cul7 UTSW 17 46659569 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAAACTGAGGTCAAGTCCTGC -3'
(R):5'- TGAAGAGCCAGGATTCTCAAG -3'

Sequencing Primer
(F):5'- ACCTCACTGTGCTCAGGTG -3'
(R):5'- AAGGACTGACTACCTTGTGC -3'
Posted On2016-05-10