Incidental Mutation 'R5015:Fmnl2'
ID385479
Institutional Source Beutler Lab
Gene Symbol Fmnl2
Ensembl Gene ENSMUSG00000036053
Gene Nameformin-like 2
Synonyms5430425K04Rik, man
MMRRC Submission 042606-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5015 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location52857860-53133804 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 53103761 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 389 (N389K)
Ref Sequence ENSEMBL: ENSMUSP00000118658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049483] [ENSMUST00000050719] [ENSMUST00000090952] [ENSMUST00000127122] [ENSMUST00000155586]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049483
AA Change: N389K

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000047260
Gene: ENSMUSG00000036053
AA Change: N389K

DomainStartEndE-ValueType
Drf_GBD 23 275 1.19e-96 SMART
Drf_FH3 278 482 8.68e-76 SMART
low complexity region 518 540 N/A INTRINSIC
SCOP:d1jvr__ 549 588 8e-3 SMART
FH2 615 1052 1.66e-124 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000050719
AA Change: N389K

PolyPhen 2 Score 0.631 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000057084
Gene: ENSMUSG00000036053
AA Change: N389K

DomainStartEndE-ValueType
Drf_GBD 23 275 1.19e-96 SMART
Drf_FH3 278 482 8.68e-76 SMART
low complexity region 518 540 N/A INTRINSIC
low complexity region 549 568 N/A INTRINSIC
FH2 581 1018 1.66e-124 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000090952
AA Change: N389K

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088472
Gene: ENSMUSG00000036053
AA Change: N389K

DomainStartEndE-ValueType
Drf_GBD 23 275 1.19e-96 SMART
Drf_FH3 278 482 8.68e-76 SMART
low complexity region 518 540 N/A INTRINSIC
SCOP:d1jvr__ 549 588 6e-3 SMART
FH2 615 1052 1.66e-124 SMART
low complexity region 1063 1075 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000127122
AA Change: N389K

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118658
Gene: ENSMUSG00000036053
AA Change: N389K

DomainStartEndE-ValueType
Drf_GBD 23 275 1.19e-96 SMART
Drf_FH3 278 482 8.68e-76 SMART
low complexity region 518 540 N/A INTRINSIC
SCOP:d1jvr__ 549 588 7e-3 SMART
FH2 615 1052 1.66e-124 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000155586
AA Change: N389K

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117822
Gene: ENSMUSG00000036053
AA Change: N389K

DomainStartEndE-ValueType
Pfam:FH2 1 131 2e-33 PFAM
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a formin-related protein. Formin-related proteins have been implicated in morphogenesis, cytokinesis, and cell polarity. Alternatively spliced transcript variants encoding different isoforms have been described but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 T A 8: 40,754,634 F312L probably benign Het
Adprm A G 11: 67,042,030 F18L possibly damaging Het
Ampd1 T G 3: 103,099,665 N735K possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp1a4 T C 1: 172,254,082 M168V probably damaging Het
Bcl6 G A 16: 23,974,850 H116Y probably damaging Het
Bmpr2 T A 1: 59,851,224 N338K probably damaging Het
Bms1 A T 6: 118,404,263 Y697* probably null Het
Ccdc33 A C 9: 58,118,635 F37C probably damaging Het
Ccdc60 T A 5: 116,288,448 Q30L probably benign Het
Cndp1 C A 18: 84,631,911 R219L probably damaging Het
D13Ertd608e T A 13: 119,836,938 probably null Het
Daam2 C A 17: 49,476,522 D627Y probably damaging Het
Dffb T C 4: 153,972,959 D87G possibly damaging Het
Dnah2 T G 11: 69,497,882 T892P possibly damaging Het
Dqx1 A G 6: 83,066,111 T610A probably benign Het
Dspp A T 5: 104,177,060 I430L possibly damaging Het
Dytn T A 1: 63,633,695 K516N probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fn1 G A 1: 71,626,177 T927I probably damaging Het
Foxn1 T C 11: 78,371,163 K127E probably damaging Het
Fpr-rs6 A G 17: 20,182,346 F251S probably damaging Het
Frrs1 A G 3: 116,878,439 D62G probably damaging Het
Fut10 T A 8: 31,236,120 V301D probably damaging Het
Gk5 A G 9: 96,177,417 probably null Het
Glipr1l1 T A 10: 112,078,374 N213K probably benign Het
Gm1110 A G 9: 26,881,866 F538S probably benign Het
Gm11492 C T 11: 87,567,217 S139F possibly damaging Het
Gm5483 T C 16: 36,186,467 probably null Het
Gm7347 T A 5: 26,057,368 T52S probably benign Het
Gsap T C 5: 21,222,408 I178T probably damaging Het
Hcn1 A T 13: 117,603,020 Q106L unknown Het
Hils1 C A 11: 94,968,102 N74K probably damaging Het
Isg20l2 G T 3: 87,931,981 L166F possibly damaging Het
Kcnq3 T A 15: 66,004,763 E510D probably damaging Het
Kif26b G T 1: 178,928,330 R2003L probably damaging Het
Kiss1r T C 10: 79,918,807 V45A probably damaging Het
Krt14 G A 11: 100,207,206 R84* probably null Het
Mbd5 T C 2: 49,258,196 M806T possibly damaging Het
Mdga1 A T 17: 29,839,873 I13N possibly damaging Het
Mfsd4b5 T C 10: 39,974,762 K73E probably benign Het
Mterf2 C T 10: 85,119,732 G343R probably benign Het
Mto1 T A 9: 78,461,621 F522I probably benign Het
Myo18b T C 5: 112,790,057 E1734G probably damaging Het
Myoz1 T C 14: 20,653,719 T53A probably benign Het
Naxd T C 8: 11,513,032 L324P probably damaging Het
Nos1 T A 5: 117,867,269 V18D probably damaging Het
Nova1 T C 12: 46,816,955 T71A unknown Het
Olfr1417 T C 19: 11,828,118 R303G probably benign Het
Olfr389 C G 11: 73,777,181 V49L probably benign Het
Olfr419 A G 1: 174,250,882 L15S possibly damaging Het
Olfr531 T C 7: 140,400,170 D292G probably damaging Het
Olfr690 A G 7: 105,329,604 V196A possibly damaging Het
Otof T A 5: 30,382,894 Y981F probably damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Pex1 A G 5: 3,620,597 K7E probably damaging Het
Pi4ka A G 16: 17,303,082 S73P possibly damaging Het
Plxnb1 T A 9: 109,100,430 I118N possibly damaging Het
Prcc T C 3: 87,872,253 D158G probably damaging Het
Ptpn7 C A 1: 135,139,139 R245S possibly damaging Het
Ptpre C T 7: 135,669,132 H346Y probably benign Het
Pwp2 A G 10: 78,182,693 C86R probably benign Het
Rfng T G 11: 120,783,050 D178A probably damaging Het
Rhpn1 T C 15: 75,708,241 I51T probably damaging Het
Rnasel G T 1: 153,754,097 E120* probably null Het
Sall2 T G 14: 52,315,655 S26R possibly damaging Het
Scn10a A G 9: 119,622,921 V1312A possibly damaging Het
Sdk2 C A 11: 113,793,761 R1958L probably damaging Het
Slc52a2 T A 15: 76,540,551 C330S probably damaging Het
Smarca2 T A 19: 26,691,388 I987N possibly damaging Het
Srrt A T 5: 137,296,009 Y486N probably damaging Het
Stat5b A T 11: 100,805,005 N50K possibly damaging Het
Strip2 T A 6: 29,931,266 D405E probably benign Het
Tnc A T 4: 64,006,502 D986E probably damaging Het
Tph2 T C 10: 115,079,716 N473S probably benign Het
Tpp1 C T 7: 105,752,025 probably benign Het
Trpm3 T C 19: 22,711,712 Y2H probably damaging Het
Ttc21a A T 9: 119,966,129 E1072V probably damaging Het
Zfat T C 15: 68,178,913 D753G probably damaging Het
Zmym2 T A 14: 56,921,594 S609T probably damaging Het
Other mutations in Fmnl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Fmnl2 APN 2 53114917 missense probably damaging 1.00
IGL00960:Fmnl2 APN 2 53123482 missense probably damaging 0.98
IGL01343:Fmnl2 APN 2 53123545 missense probably damaging 1.00
IGL01790:Fmnl2 APN 2 53118368 missense probably damaging 1.00
IGL02555:Fmnl2 APN 2 53126851 critical splice acceptor site probably null
IGL02613:Fmnl2 APN 2 53073735 critical splice donor site probably null
IGL02712:Fmnl2 APN 2 53036498 splice site probably benign
IGL02715:Fmnl2 APN 2 53072210 missense possibly damaging 0.93
IGL02750:Fmnl2 APN 2 53103697 missense possibly damaging 0.95
IGL02832:Fmnl2 APN 2 52858249 missense possibly damaging 0.90
IGL02975:Fmnl2 APN 2 53101482 missense probably benign 0.45
PIT4280001:Fmnl2 UTSW 2 53118196 missense unknown
R0529:Fmnl2 UTSW 2 53042365 missense probably damaging 1.00
R0571:Fmnl2 UTSW 2 53054491 missense probably benign 0.01
R0707:Fmnl2 UTSW 2 53054486 missense possibly damaging 0.85
R1172:Fmnl2 UTSW 2 53072274 missense probably damaging 1.00
R1473:Fmnl2 UTSW 2 52858207 missense possibly damaging 0.53
R1533:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1536:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1537:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1547:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1548:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1549:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1604:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1608:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1615:Fmnl2 UTSW 2 53118424 missense probably damaging 1.00
R1792:Fmnl2 UTSW 2 53042317 missense possibly damaging 0.79
R1965:Fmnl2 UTSW 2 53114868 missense probably damaging 1.00
R1970:Fmnl2 UTSW 2 53105576 missense possibly damaging 0.93
R2012:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R2065:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R2111:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R2112:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R2427:Fmnl2 UTSW 2 53116979 missense probably damaging 0.96
R4084:Fmnl2 UTSW 2 53107495 missense possibly damaging 0.96
R4095:Fmnl2 UTSW 2 53101523 missense probably damaging 0.99
R4607:Fmnl2 UTSW 2 53103716 missense possibly damaging 0.94
R4608:Fmnl2 UTSW 2 53103716 missense possibly damaging 0.94
R4720:Fmnl2 UTSW 2 53107540 missense possibly damaging 0.96
R4731:Fmnl2 UTSW 2 53117069 missense possibly damaging 0.95
R4947:Fmnl2 UTSW 2 53073710 missense probably benign 0.32
R5402:Fmnl2 UTSW 2 53128782 missense probably damaging 0.97
R5731:Fmnl2 UTSW 2 53118137 intron probably null
R5766:Fmnl2 UTSW 2 53101454 missense probably damaging 1.00
R5945:Fmnl2 UTSW 2 53114199 missense probably damaging 0.99
R6093:Fmnl2 UTSW 2 53114868 missense probably damaging 1.00
R6210:Fmnl2 UTSW 2 53130445 missense possibly damaging 0.94
R6287:Fmnl2 UTSW 2 53014848 missense probably damaging 1.00
R6661:Fmnl2 UTSW 2 53108285 missense probably damaging 0.98
R6967:Fmnl2 UTSW 2 53097332 missense possibly damaging 0.88
R7006:Fmnl2 UTSW 2 53108254 missense probably benign 0.27
R7146:Fmnl2 UTSW 2 53068540 missense
R7173:Fmnl2 UTSW 2 53114190 missense unknown
R7176:Fmnl2 UTSW 2 53114150 missense unknown
R7182:Fmnl2 UTSW 2 53107441 missense unknown
R7201:Fmnl2 UTSW 2 53073654 missense unknown
R7470:Fmnl2 UTSW 2 53042365 missense probably damaging 1.00
R7481:Fmnl2 UTSW 2 53108431 missense unknown
R7691:Fmnl2 UTSW 2 53101498 missense unknown
R7699:Fmnl2 UTSW 2 53036508 missense
R7700:Fmnl2 UTSW 2 53036508 missense
R7722:Fmnl2 UTSW 2 53054467 missense
R7775:Fmnl2 UTSW 2 53073680 missense unknown
R7824:Fmnl2 UTSW 2 53073680 missense unknown
Predicted Primers PCR Primer
(F):5'- TTGGGAAATTACGTTCTATGCCC -3'
(R):5'- ACTAGGATTGCCAGTGTGTG -3'

Sequencing Primer
(F):5'- TGCCCACAGATAGTTAATCCTG -3'
(R):5'- GTTCCTTCTTTAAGAACCTAGATGGC -3'
Posted On2016-05-10