Incidental Mutation 'R5015:Otof'
ID385490
Institutional Source Beutler Lab
Gene Symbol Otof
Ensembl Gene ENSMUSG00000062372
Gene Nameotoferlin
Synonyms
MMRRC Submission 042606-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.226) question?
Stock #R5015 (G1)
Quality Score188
Status Not validated
Chromosome5
Chromosomal Location30367062-30461932 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30382894 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 981 (Y981F)
Ref Sequence ENSEMBL: ENSMUSP00000110395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074171] [ENSMUST00000114747]
Predicted Effect probably damaging
Transcript: ENSMUST00000074171
AA Change: Y966F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073803
Gene: ENSMUSG00000062372
AA Change: Y966F

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 254 352 3.76e-11 SMART
FerI 338 409 7.91e-38 SMART
C2 417 528 1.75e-11 SMART
low complexity region 607 618 N/A INTRINSIC
FerB 841 917 5.13e-46 SMART
C2 960 1067 1.77e-7 SMART
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1265 1276 N/A INTRINSIC
low complexity region 1293 1323 N/A INTRINSIC
low complexity region 1370 1385 N/A INTRINSIC
low complexity region 1436 1447 N/A INTRINSIC
C2 1493 1592 6.54e-11 SMART
C2 1733 1863 4.02e0 SMART
Pfam:Ferlin_C 1895 1994 7.2e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114747
AA Change: Y981F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110395
Gene: ENSMUSG00000062372
AA Change: Y981F

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 269 367 3.76e-11 SMART
FerI 353 424 7.91e-38 SMART
C2 432 543 1.75e-11 SMART
low complexity region 622 633 N/A INTRINSIC
FerB 856 932 5.13e-46 SMART
C2 975 1082 1.77e-7 SMART
Pfam:C2 1153 1236 1.8e-1 PFAM
low complexity region 1260 1271 N/A INTRINSIC
low complexity region 1288 1318 N/A INTRINSIC
low complexity region 1365 1380 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
C2 1488 1587 6.54e-11 SMART
C2 1728 1858 4.02e0 SMART
low complexity region 1903 1915 N/A INTRINSIC
transmembrane domain 1959 1981 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000133509
AA Change: Y981F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120591
Gene: ENSMUSG00000062372
AA Change: Y981F

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 269 367 3.76e-11 SMART
FerI 353 424 7.91e-38 SMART
C2 432 543 1.75e-11 SMART
low complexity region 622 633 N/A INTRINSIC
FerB 856 932 5.13e-46 SMART
C2 975 1082 1.77e-7 SMART
Pfam:C2 1153 1236 1.4e-2 PFAM
low complexity region 1260 1271 N/A INTRINSIC
low complexity region 1288 1318 N/A INTRINSIC
low complexity region 1365 1380 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
C2 1488 1587 6.54e-11 SMART
C2 1728 1858 4.02e0 SMART
low complexity region 1903 1915 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144125
SMART Domains Protein: ENSMUSP00000120679
Gene: ENSMUSG00000062372

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 254 352 3.76e-11 SMART
FerI 338 409 7.91e-38 SMART
C2 417 528 1.75e-11 SMART
low complexity region 607 618 N/A INTRINSIC
FerB 841 917 5.13e-46 SMART
C2 960 1067 1.77e-7 SMART
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1265 1276 N/A INTRINSIC
low complexity region 1293 1323 N/A INTRINSIC
low complexity region 1370 1385 N/A INTRINSIC
low complexity region 1436 1447 N/A INTRINSIC
C2 1493 1592 6.54e-11 SMART
C2 1733 1863 4.02e0 SMART
Pfam:Ferlin_C 1895 1994 7.2e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150734
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are a cause of neurosensory nonsyndromic recessive deafness, DFNB9. The short form of the encoded protein has 3 C2 domains, a single carboxy-terminal transmembrane domain found also in the C. elegans spermatogenesis factor FER-1 and human dysferlin, while the long form has 6 C2 domains. The homology suggests that this protein may be involved in vesicle membrane fusion. Several transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants have no detectable auditory brainstem response at any frequency tested. Otoacoustic transmission distortion products are detected. Direct electrical stimulation of cochlear ganglia elicits brainstem responses. On depolarization, inner hair cells release almost no neurotransmitter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 T A 8: 40,754,634 F312L probably benign Het
Adprm A G 11: 67,042,030 F18L possibly damaging Het
Ampd1 T G 3: 103,099,665 N735K possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp1a4 T C 1: 172,254,082 M168V probably damaging Het
Bcl6 G A 16: 23,974,850 H116Y probably damaging Het
Bmpr2 T A 1: 59,851,224 N338K probably damaging Het
Bms1 A T 6: 118,404,263 Y697* probably null Het
Ccdc33 A C 9: 58,118,635 F37C probably damaging Het
Ccdc60 T A 5: 116,288,448 Q30L probably benign Het
Cndp1 C A 18: 84,631,911 R219L probably damaging Het
D13Ertd608e T A 13: 119,836,938 probably null Het
Daam2 C A 17: 49,476,522 D627Y probably damaging Het
Dffb T C 4: 153,972,959 D87G possibly damaging Het
Dnah2 T G 11: 69,497,882 T892P possibly damaging Het
Dqx1 A G 6: 83,066,111 T610A probably benign Het
Dspp A T 5: 104,177,060 I430L possibly damaging Het
Dytn T A 1: 63,633,695 K516N probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fmnl2 T A 2: 53,103,761 N389K possibly damaging Het
Fn1 G A 1: 71,626,177 T927I probably damaging Het
Foxn1 T C 11: 78,371,163 K127E probably damaging Het
Fpr-rs6 A G 17: 20,182,346 F251S probably damaging Het
Frrs1 A G 3: 116,878,439 D62G probably damaging Het
Fut10 T A 8: 31,236,120 V301D probably damaging Het
Gk5 A G 9: 96,177,417 probably null Het
Glipr1l1 T A 10: 112,078,374 N213K probably benign Het
Gm1110 A G 9: 26,881,866 F538S probably benign Het
Gm11492 C T 11: 87,567,217 S139F possibly damaging Het
Gm5483 T C 16: 36,186,467 probably null Het
Gm7347 T A 5: 26,057,368 T52S probably benign Het
Gsap T C 5: 21,222,408 I178T probably damaging Het
Hcn1 A T 13: 117,603,020 Q106L unknown Het
Hils1 C A 11: 94,968,102 N74K probably damaging Het
Isg20l2 G T 3: 87,931,981 L166F possibly damaging Het
Kcnq3 T A 15: 66,004,763 E510D probably damaging Het
Kif26b G T 1: 178,928,330 R2003L probably damaging Het
Kiss1r T C 10: 79,918,807 V45A probably damaging Het
Krt14 G A 11: 100,207,206 R84* probably null Het
Mbd5 T C 2: 49,258,196 M806T possibly damaging Het
Mdga1 A T 17: 29,839,873 I13N possibly damaging Het
Mfsd4b5 T C 10: 39,974,762 K73E probably benign Het
Mterf2 C T 10: 85,119,732 G343R probably benign Het
Mto1 T A 9: 78,461,621 F522I probably benign Het
Myo18b T C 5: 112,790,057 E1734G probably damaging Het
Myoz1 T C 14: 20,653,719 T53A probably benign Het
Naxd T C 8: 11,513,032 L324P probably damaging Het
Nos1 T A 5: 117,867,269 V18D probably damaging Het
Nova1 T C 12: 46,816,955 T71A unknown Het
Olfr1417 T C 19: 11,828,118 R303G probably benign Het
Olfr389 C G 11: 73,777,181 V49L probably benign Het
Olfr419 A G 1: 174,250,882 L15S possibly damaging Het
Olfr531 T C 7: 140,400,170 D292G probably damaging Het
Olfr690 A G 7: 105,329,604 V196A possibly damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Pex1 A G 5: 3,620,597 K7E probably damaging Het
Pi4ka A G 16: 17,303,082 S73P possibly damaging Het
Plxnb1 T A 9: 109,100,430 I118N possibly damaging Het
Prcc T C 3: 87,872,253 D158G probably damaging Het
Ptpn7 C A 1: 135,139,139 R245S possibly damaging Het
Ptpre C T 7: 135,669,132 H346Y probably benign Het
Pwp2 A G 10: 78,182,693 C86R probably benign Het
Rfng T G 11: 120,783,050 D178A probably damaging Het
Rhpn1 T C 15: 75,708,241 I51T probably damaging Het
Rnasel G T 1: 153,754,097 E120* probably null Het
Sall2 T G 14: 52,315,655 S26R possibly damaging Het
Scn10a A G 9: 119,622,921 V1312A possibly damaging Het
Sdk2 C A 11: 113,793,761 R1958L probably damaging Het
Slc52a2 T A 15: 76,540,551 C330S probably damaging Het
Smarca2 T A 19: 26,691,388 I987N possibly damaging Het
Srrt A T 5: 137,296,009 Y486N probably damaging Het
Stat5b A T 11: 100,805,005 N50K possibly damaging Het
Strip2 T A 6: 29,931,266 D405E probably benign Het
Tnc A T 4: 64,006,502 D986E probably damaging Het
Tph2 T C 10: 115,079,716 N473S probably benign Het
Tpp1 C T 7: 105,752,025 probably benign Het
Trpm3 T C 19: 22,711,712 Y2H probably damaging Het
Ttc21a A T 9: 119,966,129 E1072V probably damaging Het
Zfat T C 15: 68,178,913 D753G probably damaging Het
Zmym2 T A 14: 56,921,594 S609T probably damaging Het
Other mutations in Otof
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Otof APN 5 30375904 missense probably damaging 1.00
IGL00391:Otof APN 5 30375623 missense probably damaging 1.00
IGL00579:Otof APN 5 30399322 missense possibly damaging 0.88
IGL00671:Otof APN 5 30385753 critical splice donor site probably null
IGL01019:Otof APN 5 30405216 missense probably benign 0.01
IGL01025:Otof APN 5 30384253 missense possibly damaging 0.82
IGL01086:Otof APN 5 30376273 critical splice donor site probably null
IGL01110:Otof APN 5 30461725 missense probably damaging 1.00
IGL01160:Otof APN 5 30381535 missense probably benign 0.00
IGL01285:Otof APN 5 30405183 missense probably damaging 1.00
IGL01329:Otof APN 5 30441379 missense probably benign 0.00
IGL01337:Otof APN 5 30405777 missense possibly damaging 0.93
IGL01337:Otof APN 5 30419512 missense probably benign 0.17
IGL01834:Otof APN 5 30399220 missense probably damaging 1.00
IGL01872:Otof APN 5 30379254 splice site probably benign
IGL01969:Otof APN 5 30382483 splice site probably benign
IGL02075:Otof APN 5 30370726 missense probably benign 0.23
IGL02077:Otof APN 5 30399235 missense probably damaging 1.00
IGL02136:Otof APN 5 30373992 missense possibly damaging 0.90
IGL02227:Otof APN 5 30370784 missense probably damaging 1.00
IGL02475:Otof APN 5 30376682 missense probably damaging 1.00
IGL02812:Otof APN 5 30374082 missense probably benign 0.08
IGL02864:Otof APN 5 30386341 missense probably damaging 0.99
IGL03176:Otof APN 5 30405176 splice site probably null
R0285:Otof UTSW 5 30379533 critical splice donor site probably null
R0421:Otof UTSW 5 30371568 missense possibly damaging 0.94
R0570:Otof UTSW 5 30371881 splice site probably benign
R0599:Otof UTSW 5 30370705 missense probably damaging 1.00
R0675:Otof UTSW 5 30382361 missense probably benign 0.01
R0715:Otof UTSW 5 30394697 missense probably damaging 0.99
R1019:Otof UTSW 5 30370743 missense probably damaging 0.96
R1183:Otof UTSW 5 30371912 missense probably damaging 1.00
R1435:Otof UTSW 5 30378695 missense probably benign 0.00
R1469:Otof UTSW 5 30380227 missense probably benign 0.00
R1469:Otof UTSW 5 30380227 missense probably benign 0.00
R1474:Otof UTSW 5 30379532 critical splice donor site probably null
R1524:Otof UTSW 5 30379556 missense probably benign 0.03
R1563:Otof UTSW 5 30371005 missense probably benign 0.00
R1732:Otof UTSW 5 30386471 missense probably damaging 1.00
R1822:Otof UTSW 5 30378710 missense probably benign 0.00
R1845:Otof UTSW 5 30371723 nonsense probably null
R1925:Otof UTSW 5 30394188 missense probably benign 0.37
R1938:Otof UTSW 5 30376369 missense probably benign 0.00
R1968:Otof UTSW 5 30388654 missense probably damaging 1.00
R1996:Otof UTSW 5 30421037 missense probably benign 0.01
R1999:Otof UTSW 5 30388772 missense probably benign 0.19
R2027:Otof UTSW 5 30421014 missense probably benign 0.08
R2138:Otof UTSW 5 30461770 missense probably benign 0.01
R2173:Otof UTSW 5 30386374 missense probably damaging 1.00
R2245:Otof UTSW 5 30370207 missense probably damaging 1.00
R3011:Otof UTSW 5 30382840 missense probably damaging 1.00
R3105:Otof UTSW 5 30381801 missense probably benign 0.03
R3442:Otof UTSW 5 30371689 missense probably damaging 1.00
R3710:Otof UTSW 5 30385266 missense probably benign
R3715:Otof UTSW 5 30376871 nonsense probably null
R3806:Otof UTSW 5 30386499 critical splice acceptor site probably null
R3975:Otof UTSW 5 30370712 missense probably damaging 1.00
R4067:Otof UTSW 5 30399291 missense probably damaging 1.00
R4077:Otof UTSW 5 30419506 missense possibly damaging 0.89
R4166:Otof UTSW 5 30382418 missense probably damaging 1.00
R4451:Otof UTSW 5 30385164 missense possibly damaging 0.77
R4485:Otof UTSW 5 30375000 missense possibly damaging 0.77
R4600:Otof UTSW 5 30371900 missense probably damaging 1.00
R4646:Otof UTSW 5 30383570 missense possibly damaging 0.82
R4648:Otof UTSW 5 30383570 missense possibly damaging 0.82
R4669:Otof UTSW 5 30420974 critical splice donor site probably null
R4773:Otof UTSW 5 30394682 missense probably benign 0.05
R4839:Otof UTSW 5 30419404 missense probably damaging 0.99
R4907:Otof UTSW 5 30378661 critical splice donor site probably null
R4961:Otof UTSW 5 30383493 intron probably benign
R4991:Otof UTSW 5 30394181 missense probably damaging 1.00
R5036:Otof UTSW 5 30384439 missense possibly damaging 0.54
R5038:Otof UTSW 5 30384439 missense possibly damaging 0.54
R5253:Otof UTSW 5 30370139 missense probably damaging 1.00
R5336:Otof UTSW 5 30376720 missense probably benign 0.01
R5365:Otof UTSW 5 30381800 missense probably damaging 0.99
R5901:Otof UTSW 5 30374979 missense probably damaging 1.00
R6211:Otof UTSW 5 30371900 missense probably damaging 0.99
R6318:Otof UTSW 5 30414544 missense probably damaging 1.00
R6331:Otof UTSW 5 30371935 missense possibly damaging 0.94
R6671:Otof UTSW 5 30419533 missense probably benign
R6701:Otof UTSW 5 30370797 nonsense probably null
R6792:Otof UTSW 5 30375634 missense probably damaging 1.00
R6853:Otof UTSW 5 30388239 missense probably damaging 1.00
R6940:Otof UTSW 5 30371643 missense probably damaging 0.96
R7037:Otof UTSW 5 30381538 missense probably benign 0.32
R7060:Otof UTSW 5 30388356 missense possibly damaging 0.84
R7089:Otof UTSW 5 30371568 missense possibly damaging 0.94
R7165:Otof UTSW 5 30375620 missense probably damaging 0.99
R7178:Otof UTSW 5 30383534 missense possibly damaging 0.50
R7298:Otof UTSW 5 30388270 missense probably damaging 1.00
R7393:Otof UTSW 5 30370270 missense probably benign 0.45
R7397:Otof UTSW 5 30375707 missense probably damaging 1.00
R7400:Otof UTSW 5 30385188 missense probably benign 0.04
R7428:Otof UTSW 5 30389825 missense probably damaging 1.00
R7456:Otof UTSW 5 30394661 missense probably damaging 1.00
R7505:Otof UTSW 5 30371020 missense probably benign 0.00
R7714:Otof UTSW 5 30370253 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTAGCAGGCCAATAGTACTGG -3'
(R):5'- GCAAGCAGCGAAAGGACTTC -3'

Sequencing Primer
(F):5'- GCCTCCCAGTTCTCCCAAAAG -3'
(R):5'- CTTCGAGGAGGTCAAGGC -3'
Posted On2016-05-10