Incidental Mutation 'R5015:Srrt'
ID385494
Institutional Source Beutler Lab
Gene Symbol Srrt
Ensembl Gene ENSMUSG00000037364
Gene Nameserrate RNA effector molecule homolog (Arabidopsis)
Synonyms2810019G02Rik, Asr2, Ars2
MMRRC Submission 042606-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5015 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location137295704-137307674 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 137296009 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 486 (Y486N)
Ref Sequence ENSEMBL: ENSMUSP00000142351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024099] [ENSMUST00000040873] [ENSMUST00000052825] [ENSMUST00000085934] [ENSMUST00000196109] [ENSMUST00000196208] [ENSMUST00000197466] [ENSMUST00000198526] [ENSMUST00000199243]
Predicted Effect probably benign
Transcript: ENSMUST00000024099
SMART Domains Protein: ENSMUSP00000024099
Gene: ENSMUSG00000023328

DomainStartEndE-ValueType
Pfam:COesterase 14 563 2e-186 PFAM
Pfam:Abhydrolase_3 146 276 7.5e-9 PFAM
Pfam:AChE_tetra 578 614 3.2e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000040873
AA Change: Y844N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000043123
Gene: ENSMUSG00000037364
AA Change: Y844N

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 153 262 3.8e-44 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 645 850 9.7e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052825
SMART Domains Protein: ENSMUSP00000056156
Gene: ENSMUSG00000051502

DomainStartEndE-ValueType
Pfam:Peptidase_C78 27 212 5.4e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085934
SMART Domains Protein: ENSMUSP00000083097
Gene: ENSMUSG00000023328

DomainStartEndE-ValueType
Pfam:COesterase 15 563 3e-178 PFAM
Pfam:Abhydrolase_3 146 260 1.4e-7 PFAM
Pfam:AChE_tetra 578 613 3.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150983
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184134
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184197
Predicted Effect probably damaging
Transcript: ENSMUST00000196109
AA Change: Y486N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142351
Gene: ENSMUSG00000037364
AA Change: Y486N

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
Blast:RRM 65 133 2e-15 BLAST
low complexity region 208 237 N/A INTRINSIC
low complexity region 245 257 N/A INTRINSIC
Pfam:ARS2 277 498 6.5e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196208
SMART Domains Protein: ENSMUSP00000142427
Gene: ENSMUSG00000023328

DomainStartEndE-ValueType
Pfam:COesterase 14 359 6.5e-134 PFAM
Pfam:Abhydrolase_3 146 284 4.1e-7 PFAM
Pfam:COesterase 355 475 1.5e-25 PFAM
Pfam:AChE_tetra 490 526 2.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196394
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197376
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197409
Predicted Effect possibly damaging
Transcript: ENSMUST00000197466
AA Change: Y833N

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142564
Gene: ENSMUSG00000037364
AA Change: Y833N

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 9.5e-48 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 635 845 5.5e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198526
SMART Domains Protein: ENSMUSP00000142435
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 2e-45 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 322 347 N/A INTRINSIC
low complexity region 369 408 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199243
AA Change: Y837N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143232
Gene: ENSMUSG00000037364
AA Change: Y837N

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 9.5e-48 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 635 849 9.8e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199473
Predicted Effect probably benign
Transcript: ENSMUST00000199605
Predicted Effect unknown
Transcript: ENSMUST00000199756
AA Change: Y262N
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200643
Predicted Effect probably benign
Transcript: ENSMUST00000223263
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display embryonic lethality before somite formation, increased apoptosis, and when cultured most fail to hatch from the zona pellucida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 T A 8: 40,754,634 F312L probably benign Het
Adprm A G 11: 67,042,030 F18L possibly damaging Het
Ampd1 T G 3: 103,099,665 N735K possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp1a4 T C 1: 172,254,082 M168V probably damaging Het
Bcl6 G A 16: 23,974,850 H116Y probably damaging Het
Bmpr2 T A 1: 59,851,224 N338K probably damaging Het
Bms1 A T 6: 118,404,263 Y697* probably null Het
Ccdc33 A C 9: 58,118,635 F37C probably damaging Het
Ccdc60 T A 5: 116,288,448 Q30L probably benign Het
Cndp1 C A 18: 84,631,911 R219L probably damaging Het
D13Ertd608e T A 13: 119,836,938 probably null Het
Daam2 C A 17: 49,476,522 D627Y probably damaging Het
Dffb T C 4: 153,972,959 D87G possibly damaging Het
Dnah2 T G 11: 69,497,882 T892P possibly damaging Het
Dqx1 A G 6: 83,066,111 T610A probably benign Het
Dspp A T 5: 104,177,060 I430L possibly damaging Het
Dytn T A 1: 63,633,695 K516N probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fmnl2 T A 2: 53,103,761 N389K possibly damaging Het
Fn1 G A 1: 71,626,177 T927I probably damaging Het
Foxn1 T C 11: 78,371,163 K127E probably damaging Het
Fpr-rs6 A G 17: 20,182,346 F251S probably damaging Het
Frrs1 A G 3: 116,878,439 D62G probably damaging Het
Fut10 T A 8: 31,236,120 V301D probably damaging Het
Gk5 A G 9: 96,177,417 probably null Het
Glipr1l1 T A 10: 112,078,374 N213K probably benign Het
Gm1110 A G 9: 26,881,866 F538S probably benign Het
Gm11492 C T 11: 87,567,217 S139F possibly damaging Het
Gm5483 T C 16: 36,186,467 probably null Het
Gm7347 T A 5: 26,057,368 T52S probably benign Het
Gsap T C 5: 21,222,408 I178T probably damaging Het
Hcn1 A T 13: 117,603,020 Q106L unknown Het
Hils1 C A 11: 94,968,102 N74K probably damaging Het
Isg20l2 G T 3: 87,931,981 L166F possibly damaging Het
Kcnq3 T A 15: 66,004,763 E510D probably damaging Het
Kif26b G T 1: 178,928,330 R2003L probably damaging Het
Kiss1r T C 10: 79,918,807 V45A probably damaging Het
Krt14 G A 11: 100,207,206 R84* probably null Het
Mbd5 T C 2: 49,258,196 M806T possibly damaging Het
Mdga1 A T 17: 29,839,873 I13N possibly damaging Het
Mfsd4b5 T C 10: 39,974,762 K73E probably benign Het
Mterf2 C T 10: 85,119,732 G343R probably benign Het
Mto1 T A 9: 78,461,621 F522I probably benign Het
Myo18b T C 5: 112,790,057 E1734G probably damaging Het
Myoz1 T C 14: 20,653,719 T53A probably benign Het
Naxd T C 8: 11,513,032 L324P probably damaging Het
Nos1 T A 5: 117,867,269 V18D probably damaging Het
Nova1 T C 12: 46,816,955 T71A unknown Het
Olfr1417 T C 19: 11,828,118 R303G probably benign Het
Olfr389 C G 11: 73,777,181 V49L probably benign Het
Olfr419 A G 1: 174,250,882 L15S possibly damaging Het
Olfr531 T C 7: 140,400,170 D292G probably damaging Het
Olfr690 A G 7: 105,329,604 V196A possibly damaging Het
Otof T A 5: 30,382,894 Y981F probably damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Pex1 A G 5: 3,620,597 K7E probably damaging Het
Pi4ka A G 16: 17,303,082 S73P possibly damaging Het
Plxnb1 T A 9: 109,100,430 I118N possibly damaging Het
Prcc T C 3: 87,872,253 D158G probably damaging Het
Ptpn7 C A 1: 135,139,139 R245S possibly damaging Het
Ptpre C T 7: 135,669,132 H346Y probably benign Het
Pwp2 A G 10: 78,182,693 C86R probably benign Het
Rfng T G 11: 120,783,050 D178A probably damaging Het
Rhpn1 T C 15: 75,708,241 I51T probably damaging Het
Rnasel G T 1: 153,754,097 E120* probably null Het
Sall2 T G 14: 52,315,655 S26R possibly damaging Het
Scn10a A G 9: 119,622,921 V1312A possibly damaging Het
Sdk2 C A 11: 113,793,761 R1958L probably damaging Het
Slc52a2 T A 15: 76,540,551 C330S probably damaging Het
Smarca2 T A 19: 26,691,388 I987N possibly damaging Het
Stat5b A T 11: 100,805,005 N50K possibly damaging Het
Strip2 T A 6: 29,931,266 D405E probably benign Het
Tnc A T 4: 64,006,502 D986E probably damaging Het
Tph2 T C 10: 115,079,716 N473S probably benign Het
Tpp1 C T 7: 105,752,025 probably benign Het
Trpm3 T C 19: 22,711,712 Y2H probably damaging Het
Ttc21a A T 9: 119,966,129 E1072V probably damaging Het
Zfat T C 15: 68,178,913 D753G probably damaging Het
Zmym2 T A 14: 56,921,594 S609T probably damaging Het
Other mutations in Srrt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Srrt APN 5 137295978 unclassified probably benign
IGL01062:Srrt APN 5 137296307 missense probably damaging 1.00
IGL02227:Srrt APN 5 137296274 missense probably damaging 1.00
IGL02656:Srrt APN 5 137299676 unclassified probably benign
IGL03105:Srrt APN 5 137299844 missense possibly damaging 0.72
IGL03137:Srrt APN 5 137296117 unclassified probably benign
R0281:Srrt UTSW 5 137296127 unclassified probably benign
R0322:Srrt UTSW 5 137296608 missense probably damaging 1.00
R0347:Srrt UTSW 5 137299676 unclassified probably benign
R1253:Srrt UTSW 5 137300336 missense probably benign 0.01
R1397:Srrt UTSW 5 137300261 missense possibly damaging 0.89
R1520:Srrt UTSW 5 137298766 missense probably damaging 0.99
R1561:Srrt UTSW 5 137300019 missense probably benign 0.24
R1645:Srrt UTSW 5 137302139 nonsense probably null
R1759:Srrt UTSW 5 137302950 missense probably damaging 1.00
R1770:Srrt UTSW 5 137299860 unclassified probably benign
R1795:Srrt UTSW 5 137303012 unclassified probably benign
R1848:Srrt UTSW 5 137296945 missense probably damaging 1.00
R3838:Srrt UTSW 5 137302125 critical splice donor site probably null
R5068:Srrt UTSW 5 137296541 missense possibly damaging 0.93
R5163:Srrt UTSW 5 137296773 critical splice donor site probably null
R5316:Srrt UTSW 5 137296551 missense probably benign 0.16
R5343:Srrt UTSW 5 137297165 missense probably damaging 1.00
R5351:Srrt UTSW 5 137298284 makesense probably null
R5412:Srrt UTSW 5 137296287 missense probably damaging 1.00
R5806:Srrt UTSW 5 137297917 missense probably damaging 0.98
R6470:Srrt UTSW 5 137302656 missense probably damaging 1.00
R6497:Srrt UTSW 5 137297506 missense probably damaging 1.00
R6755:Srrt UTSW 5 137302930 missense probably damaging 1.00
R6828:Srrt UTSW 5 137296968 missense probably damaging 1.00
R6875:Srrt UTSW 5 137298673 missense probably benign 0.00
R7586:Srrt UTSW 5 137302195 missense probably damaging 0.98
R7677:Srrt UTSW 5 137300148 missense probably damaging 0.99
R8027:Srrt UTSW 5 137302499 frame shift probably null
RF018:Srrt UTSW 5 137300000 missense probably benign 0.23
Z1176:Srrt UTSW 5 137298227 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGTCACGGGTACTGATGTAG -3'
(R):5'- GTCTGTAGGCGGCTACAAAG -3'

Sequencing Primer
(F):5'- TCACGGGTACTGATGTAGCAATGC -3'
(R):5'- GCTTAGGCTGAGGTTGAGGTCAG -3'
Posted On2016-05-10