Incidental Mutation 'R5015:Olfr531'
ID385502
Institutional Source Beutler Lab
Gene Symbol Olfr531
Ensembl Gene ENSMUSG00000062712
Gene Nameolfactory receptor 531
SynonymsGA_x6K02T2PBJ9-42551260-42550346, MOR251-3
MMRRC Submission 042606-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R5015 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location140399045-140402918 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140400170 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 292 (D292G)
Ref Sequence ENSEMBL: ENSMUSP00000149942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080153] [ENSMUST00000216053] [ENSMUST00000217167]
Predicted Effect probably damaging
Transcript: ENSMUST00000080153
AA Change: D292G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079048
Gene: ENSMUSG00000062712
AA Change: D292G

DomainStartEndE-ValueType
Pfam:7tm_4 28 303 6.3e-46 PFAM
Pfam:7tm_1 38 286 1.5e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216053
AA Change: D292G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217032
Predicted Effect probably damaging
Transcript: ENSMUST00000217167
AA Change: D292G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 T A 8: 40,754,634 F312L probably benign Het
Adprm A G 11: 67,042,030 F18L possibly damaging Het
Ampd1 T G 3: 103,099,665 N735K possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp1a4 T C 1: 172,254,082 M168V probably damaging Het
Bcl6 G A 16: 23,974,850 H116Y probably damaging Het
Bmpr2 T A 1: 59,851,224 N338K probably damaging Het
Bms1 A T 6: 118,404,263 Y697* probably null Het
Ccdc33 A C 9: 58,118,635 F37C probably damaging Het
Ccdc60 T A 5: 116,288,448 Q30L probably benign Het
Cndp1 C A 18: 84,631,911 R219L probably damaging Het
D13Ertd608e T A 13: 119,836,938 probably null Het
Daam2 C A 17: 49,476,522 D627Y probably damaging Het
Dffb T C 4: 153,972,959 D87G possibly damaging Het
Dnah2 T G 11: 69,497,882 T892P possibly damaging Het
Dqx1 A G 6: 83,066,111 T610A probably benign Het
Dspp A T 5: 104,177,060 I430L possibly damaging Het
Dytn T A 1: 63,633,695 K516N probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fmnl2 T A 2: 53,103,761 N389K possibly damaging Het
Fn1 G A 1: 71,626,177 T927I probably damaging Het
Foxn1 T C 11: 78,371,163 K127E probably damaging Het
Fpr-rs6 A G 17: 20,182,346 F251S probably damaging Het
Frrs1 A G 3: 116,878,439 D62G probably damaging Het
Fut10 T A 8: 31,236,120 V301D probably damaging Het
Gk5 A G 9: 96,177,417 probably null Het
Glipr1l1 T A 10: 112,078,374 N213K probably benign Het
Gm1110 A G 9: 26,881,866 F538S probably benign Het
Gm11492 C T 11: 87,567,217 S139F possibly damaging Het
Gm5483 T C 16: 36,186,467 probably null Het
Gm7347 T A 5: 26,057,368 T52S probably benign Het
Gsap T C 5: 21,222,408 I178T probably damaging Het
Hcn1 A T 13: 117,603,020 Q106L unknown Het
Hils1 C A 11: 94,968,102 N74K probably damaging Het
Isg20l2 G T 3: 87,931,981 L166F possibly damaging Het
Kcnq3 T A 15: 66,004,763 E510D probably damaging Het
Kif26b G T 1: 178,928,330 R2003L probably damaging Het
Kiss1r T C 10: 79,918,807 V45A probably damaging Het
Krt14 G A 11: 100,207,206 R84* probably null Het
Mbd5 T C 2: 49,258,196 M806T possibly damaging Het
Mdga1 A T 17: 29,839,873 I13N possibly damaging Het
Mfsd4b5 T C 10: 39,974,762 K73E probably benign Het
Mterf2 C T 10: 85,119,732 G343R probably benign Het
Mto1 T A 9: 78,461,621 F522I probably benign Het
Myo18b T C 5: 112,790,057 E1734G probably damaging Het
Myoz1 T C 14: 20,653,719 T53A probably benign Het
Naxd T C 8: 11,513,032 L324P probably damaging Het
Nos1 T A 5: 117,867,269 V18D probably damaging Het
Nova1 T C 12: 46,816,955 T71A unknown Het
Olfr1417 T C 19: 11,828,118 R303G probably benign Het
Olfr389 C G 11: 73,777,181 V49L probably benign Het
Olfr419 A G 1: 174,250,882 L15S possibly damaging Het
Olfr690 A G 7: 105,329,604 V196A possibly damaging Het
Otof T A 5: 30,382,894 Y981F probably damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Pex1 A G 5: 3,620,597 K7E probably damaging Het
Pi4ka A G 16: 17,303,082 S73P possibly damaging Het
Plxnb1 T A 9: 109,100,430 I118N possibly damaging Het
Prcc T C 3: 87,872,253 D158G probably damaging Het
Ptpn7 C A 1: 135,139,139 R245S possibly damaging Het
Ptpre C T 7: 135,669,132 H346Y probably benign Het
Pwp2 A G 10: 78,182,693 C86R probably benign Het
Rfng T G 11: 120,783,050 D178A probably damaging Het
Rhpn1 T C 15: 75,708,241 I51T probably damaging Het
Rnasel G T 1: 153,754,097 E120* probably null Het
Sall2 T G 14: 52,315,655 S26R possibly damaging Het
Scn10a A G 9: 119,622,921 V1312A possibly damaging Het
Sdk2 C A 11: 113,793,761 R1958L probably damaging Het
Slc52a2 T A 15: 76,540,551 C330S probably damaging Het
Smarca2 T A 19: 26,691,388 I987N possibly damaging Het
Srrt A T 5: 137,296,009 Y486N probably damaging Het
Stat5b A T 11: 100,805,005 N50K possibly damaging Het
Strip2 T A 6: 29,931,266 D405E probably benign Het
Tnc A T 4: 64,006,502 D986E probably damaging Het
Tph2 T C 10: 115,079,716 N473S probably benign Het
Tpp1 C T 7: 105,752,025 probably benign Het
Trpm3 T C 19: 22,711,712 Y2H probably damaging Het
Ttc21a A T 9: 119,966,129 E1072V probably damaging Het
Zfat T C 15: 68,178,913 D753G probably damaging Het
Zmym2 T A 14: 56,921,594 S609T probably damaging Het
Other mutations in Olfr531
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01750:Olfr531 APN 7 140400657 missense probably benign
IGL02190:Olfr531 APN 7 140400120 utr 3 prime probably benign
IGL02548:Olfr531 APN 7 140400662 missense probably damaging 1.00
R0200:Olfr531 UTSW 7 140400875 missense probably damaging 1.00
R0589:Olfr531 UTSW 7 140400900 missense possibly damaging 0.94
R1325:Olfr531 UTSW 7 140400881 missense probably damaging 1.00
R1985:Olfr531 UTSW 7 140400800 missense possibly damaging 0.68
R4671:Olfr531 UTSW 7 140400305 missense probably damaging 1.00
R4754:Olfr531 UTSW 7 140400159 missense probably damaging 0.99
R4941:Olfr531 UTSW 7 140400879 missense probably benign 0.24
R5070:Olfr531 UTSW 7 140400569 missense probably benign 0.00
R5244:Olfr531 UTSW 7 140400138 missense probably benign 0.00
R5883:Olfr531 UTSW 7 140400188 missense probably damaging 1.00
R6437:Olfr531 UTSW 7 140400521 missense probably damaging 1.00
R7246:Olfr531 UTSW 7 140400148 missense probably benign 0.34
R7396:Olfr531 UTSW 7 140400563 missense probably benign 0.00
R7742:Olfr531 UTSW 7 140400321 missense probably benign 0.01
R7789:Olfr531 UTSW 7 140400697 nonsense probably null
R7799:Olfr531 UTSW 7 140400464 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAAGTGCAGCAGTCCAAC -3'
(R):5'- TATTGTGGCCAGCATCCTGAAG -3'

Sequencing Primer
(F):5'- TGCAGCAGTCCAACAGTTGTC -3'
(R):5'- ATCCTGAAGATCCGCTCAGCTG -3'
Posted On2016-05-10