Incidental Mutation 'R5015:Tph2'
ID385518
Institutional Source Beutler Lab
Gene Symbol Tph2
Ensembl Gene ENSMUSG00000006764
Gene Nametryptophan hydroxylase 2
Synonyms
MMRRC Submission 042606-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R5015 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location115078641-115185022 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115079716 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 473 (N473S)
Ref Sequence ENSEMBL: ENSMUSP00000006949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006949]
Predicted Effect probably benign
Transcript: ENSMUST00000006949
AA Change: N473S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000006949
Gene: ENSMUSG00000006764
AA Change: N473S

DomainStartEndE-ValueType
low complexity region 94 102 N/A INTRINSIC
Pfam:Biopterin_H 150 480 3.6e-177 PFAM
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the pterin-dependent aromatic acid hydroxylase family. The encoded protein catalyzes the first and rate limiting step in the biosynthesis of serotonin, an important hormone and neurotransmitter. Mutations in this gene may be associated with psychiatric diseases such as bipolar affective disorder and major depression. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mutations in this locus result in abnormal serotonin levels in the brain. Whether an increase or decrease in serotonin levels is seen depends on the specific nucleotide substitution/point mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 T A 8: 40,754,634 F312L probably benign Het
Adprm A G 11: 67,042,030 F18L possibly damaging Het
Ampd1 T G 3: 103,099,665 N735K possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp1a4 T C 1: 172,254,082 M168V probably damaging Het
Bcl6 G A 16: 23,974,850 H116Y probably damaging Het
Bmpr2 T A 1: 59,851,224 N338K probably damaging Het
Bms1 A T 6: 118,404,263 Y697* probably null Het
Ccdc33 A C 9: 58,118,635 F37C probably damaging Het
Ccdc60 T A 5: 116,288,448 Q30L probably benign Het
Cndp1 C A 18: 84,631,911 R219L probably damaging Het
D13Ertd608e T A 13: 119,836,938 probably null Het
Daam2 C A 17: 49,476,522 D627Y probably damaging Het
Dffb T C 4: 153,972,959 D87G possibly damaging Het
Dnah2 T G 11: 69,497,882 T892P possibly damaging Het
Dqx1 A G 6: 83,066,111 T610A probably benign Het
Dspp A T 5: 104,177,060 I430L possibly damaging Het
Dytn T A 1: 63,633,695 K516N probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fmnl2 T A 2: 53,103,761 N389K possibly damaging Het
Fn1 G A 1: 71,626,177 T927I probably damaging Het
Foxn1 T C 11: 78,371,163 K127E probably damaging Het
Fpr-rs6 A G 17: 20,182,346 F251S probably damaging Het
Frrs1 A G 3: 116,878,439 D62G probably damaging Het
Fut10 T A 8: 31,236,120 V301D probably damaging Het
Gk5 A G 9: 96,177,417 probably null Het
Glipr1l1 T A 10: 112,078,374 N213K probably benign Het
Gm1110 A G 9: 26,881,866 F538S probably benign Het
Gm11492 C T 11: 87,567,217 S139F possibly damaging Het
Gm5483 T C 16: 36,186,467 probably null Het
Gm7347 T A 5: 26,057,368 T52S probably benign Het
Gsap T C 5: 21,222,408 I178T probably damaging Het
Hcn1 A T 13: 117,603,020 Q106L unknown Het
Hils1 C A 11: 94,968,102 N74K probably damaging Het
Isg20l2 G T 3: 87,931,981 L166F possibly damaging Het
Kcnq3 T A 15: 66,004,763 E510D probably damaging Het
Kif26b G T 1: 178,928,330 R2003L probably damaging Het
Kiss1r T C 10: 79,918,807 V45A probably damaging Het
Krt14 G A 11: 100,207,206 R84* probably null Het
Mbd5 T C 2: 49,258,196 M806T possibly damaging Het
Mdga1 A T 17: 29,839,873 I13N possibly damaging Het
Mfsd4b5 T C 10: 39,974,762 K73E probably benign Het
Mterf2 C T 10: 85,119,732 G343R probably benign Het
Mto1 T A 9: 78,461,621 F522I probably benign Het
Myo18b T C 5: 112,790,057 E1734G probably damaging Het
Myoz1 T C 14: 20,653,719 T53A probably benign Het
Naxd T C 8: 11,513,032 L324P probably damaging Het
Nos1 T A 5: 117,867,269 V18D probably damaging Het
Nova1 T C 12: 46,816,955 T71A unknown Het
Olfr1417 T C 19: 11,828,118 R303G probably benign Het
Olfr389 C G 11: 73,777,181 V49L probably benign Het
Olfr419 A G 1: 174,250,882 L15S possibly damaging Het
Olfr531 T C 7: 140,400,170 D292G probably damaging Het
Olfr690 A G 7: 105,329,604 V196A possibly damaging Het
Otof T A 5: 30,382,894 Y981F probably damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Pex1 A G 5: 3,620,597 K7E probably damaging Het
Pi4ka A G 16: 17,303,082 S73P possibly damaging Het
Plxnb1 T A 9: 109,100,430 I118N possibly damaging Het
Prcc T C 3: 87,872,253 D158G probably damaging Het
Ptpn7 C A 1: 135,139,139 R245S possibly damaging Het
Ptpre C T 7: 135,669,132 H346Y probably benign Het
Pwp2 A G 10: 78,182,693 C86R probably benign Het
Rfng T G 11: 120,783,050 D178A probably damaging Het
Rhpn1 T C 15: 75,708,241 I51T probably damaging Het
Rnasel G T 1: 153,754,097 E120* probably null Het
Sall2 T G 14: 52,315,655 S26R possibly damaging Het
Scn10a A G 9: 119,622,921 V1312A possibly damaging Het
Sdk2 C A 11: 113,793,761 R1958L probably damaging Het
Slc52a2 T A 15: 76,540,551 C330S probably damaging Het
Smarca2 T A 19: 26,691,388 I987N possibly damaging Het
Srrt A T 5: 137,296,009 Y486N probably damaging Het
Stat5b A T 11: 100,805,005 N50K possibly damaging Het
Strip2 T A 6: 29,931,266 D405E probably benign Het
Tnc A T 4: 64,006,502 D986E probably damaging Het
Tpp1 C T 7: 105,752,025 probably benign Het
Trpm3 T C 19: 22,711,712 Y2H probably damaging Het
Ttc21a A T 9: 119,966,129 E1072V probably damaging Het
Zfat T C 15: 68,178,913 D753G probably damaging Het
Zmym2 T A 14: 56,921,594 S609T probably damaging Het
Other mutations in Tph2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Tph2 APN 10 115079759 nonsense probably null
IGL01989:Tph2 APN 10 115146016 missense probably benign 0.22
IGL02363:Tph2 APN 10 115079981 missense probably benign 0.01
IGL02667:Tph2 APN 10 115080045 missense probably benign 0.43
R0390:Tph2 UTSW 10 115174109 missense probably damaging 1.00
R0400:Tph2 UTSW 10 115080120 splice site probably benign
R0570:Tph2 UTSW 10 115174134 splice site probably benign
R1466:Tph2 UTSW 10 115079695 missense probably benign
R1466:Tph2 UTSW 10 115079695 missense probably benign
R1654:Tph2 UTSW 10 115184807 missense probably benign
R3705:Tph2 UTSW 10 115119893 nonsense probably null
R3710:Tph2 UTSW 10 115174058 missense probably benign 0.42
R3777:Tph2 UTSW 10 115080005 missense probably benign
R4794:Tph2 UTSW 10 115182770 missense possibly damaging 0.84
R5068:Tph2 UTSW 10 115151174 missense probably benign 0.00
R5069:Tph2 UTSW 10 115151174 missense probably benign 0.00
R5070:Tph2 UTSW 10 115151174 missense probably benign 0.00
R5422:Tph2 UTSW 10 115079764 missense possibly damaging 0.94
R5487:Tph2 UTSW 10 115119874 missense probably damaging 1.00
R5604:Tph2 UTSW 10 115090709 missense probably damaging 1.00
R5692:Tph2 UTSW 10 115184827 missense probably damaging 0.97
R6368:Tph2 UTSW 10 115179326 missense probably damaging 1.00
R6802:Tph2 UTSW 10 115184873 missense probably damaging 1.00
R6823:Tph2 UTSW 10 115174106 missense probably benign 0.02
R7371:Tph2 UTSW 10 115151111 missense probably damaging 1.00
R7724:Tph2 UTSW 10 115079822 missense probably benign
R7863:Tph2 UTSW 10 115080001 missense probably damaging 1.00
R8046:Tph2 UTSW 10 115179594 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- ATGGACATACAGAATTGCATGC -3'
(R):5'- TCGGACAGTTTTGAAGAAGCC -3'

Sequencing Primer
(F):5'- GACATACAGAATTGCATGCTTACTAG -3'
(R):5'- TCGGTATACTTCAACCCC -3'
Posted On2016-05-10