Incidental Mutation 'R0374:Olfr262'
ID38552
Institutional Source Beutler Lab
Gene Symbol Olfr262
Ensembl Gene ENSMUSG00000067519
Gene Nameolfactory receptor 262
SynonymsMOR214-1, GA_x6K02T2N4A9-18144-19082, MOR214-9
MMRRC Submission 038580-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R0374 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location12240721-12241659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12241141 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 173 (N173K)
Ref Sequence ENSEMBL: ENSMUSP00000085120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087818]
Predicted Effect probably damaging
Transcript: ENSMUST00000087818
AA Change: N173K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085120
Gene: ENSMUSG00000067519
AA Change: N173K

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 2.3e-55 PFAM
Pfam:7tm_1 42 291 1.2e-20 PFAM
Meta Mutation Damage Score 0.3153 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik T A 7: 140,248,961 C178S probably damaging Het
Ano9 A G 7: 141,107,814 I267T probably damaging Het
Anxa6 T A 11: 55,005,828 N168I probably benign Het
Apbb1ip A G 2: 22,819,705 probably benign Het
Aqr G A 2: 114,130,611 H723Y probably damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
Car13 A G 3: 14,656,297 probably benign Het
Casp9 T A 4: 141,807,173 I298N possibly damaging Het
Ccdc66 T C 14: 27,498,473 E261G probably damaging Het
Cep192 T A 18: 67,818,883 Y376* probably null Het
Cped1 T A 6: 22,222,546 probably benign Het
Ctbp2 A T 7: 132,999,344 S563R possibly damaging Het
Ctdp1 A G 18: 80,447,422 probably null Het
Dgka G C 10: 128,721,083 probably benign Het
Drd2 A G 9: 49,399,784 T112A probably benign Het
Dusp1 A G 17: 26,508,169 V52A probably damaging Het
Eea1 T A 10: 96,039,772 probably benign Het
Etfrf1 T C 6: 145,215,562 V86A probably benign Het
Fbn1 A T 2: 125,321,676 C2087S possibly damaging Het
Fosb T G 7: 19,307,150 R139S probably damaging Het
Foxm1 C T 6: 128,372,603 R362W probably damaging Het
Frem2 A G 3: 53,653,960 V1042A probably damaging Het
Gbe1 A G 16: 70,483,914 H401R probably benign Het
Gm10549 C T 18: 33,464,182 probably benign Het
Golga7b A T 19: 42,263,319 probably benign Het
H2-DMb1 T C 17: 34,159,425 V235A probably benign Het
Hr A G 14: 70,556,476 T59A probably benign Het
Itpr2 C A 6: 146,359,392 A588S probably benign Het
Kmt2c G A 5: 25,309,708 P3046S probably damaging Het
Lamc1 G A 1: 153,251,065 probably benign Het
Lrp2 A G 2: 69,430,307 Y4527H probably damaging Het
Map3k2 G A 18: 32,212,173 probably null Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Nfs1 C G 2: 156,132,660 G212R probably damaging Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Nrap T A 19: 56,351,622 Y740F probably damaging Het
Nup205 T A 6: 35,208,837 M859K probably damaging Het
Nxf1 T C 19: 8,767,739 F451S possibly damaging Het
Olfr804 G A 10: 129,705,647 M256I probably benign Het
Pcdhac2 T C 18: 37,145,667 Y567H probably damaging Het
Phlpp2 C T 8: 109,907,513 R242W probably damaging Het
Pi4ka A G 16: 17,282,932 probably benign Het
Pmpcb A G 5: 21,748,831 D359G probably damaging Het
Poll T G 19: 45,557,870 S244R probably benign Het
Prkd3 T C 17: 78,957,215 D657G probably null Het
Prune2 G A 19: 17,120,910 M1259I probably benign Het
Ptpra T A 2: 130,537,621 M329K probably damaging Het
Rbm10 GGGAGGAGGAGGAGGAGGAGGATGAGGAGGAGGAGGAGGAG GGGAGGAGGAGGAGGAGGATGAGGAGGAGGAGGAGGAG X: 20,637,559 probably benign Het
Rbm15 G T 3: 107,330,564 D839E probably damaging Het
Sap30bp T A 11: 115,964,277 I271N probably damaging Het
Scn3a A T 2: 65,508,574 V587E probably damaging Het
Setdb1 A T 3: 95,324,853 probably benign Het
Sgk3 T A 1: 9,879,081 probably null Het
Shox2 A T 3: 66,973,851 H265Q probably damaging Het
Slc9a2 T C 1: 40,743,857 F427S possibly damaging Het
Smarca5 T A 8: 80,736,731 Q69H probably benign Het
Specc1l T A 10: 75,248,459 F672Y probably damaging Het
Ssh2 T A 11: 77,408,143 S105R probably damaging Het
Syne2 C T 12: 75,921,226 R917* probably null Het
Tbc1d2 G A 4: 46,649,913 T41M possibly damaging Het
Tbx18 T A 9: 87,724,355 I246F probably damaging Het
Tcf4 T A 18: 69,681,812 probably benign Het
Tmed2 C A 5: 124,541,439 probably null Het
Tmem243 A T 5: 9,101,361 D15V possibly damaging Het
Vmn2r87 T A 10: 130,471,979 S797C probably damaging Het
Vps13c T A 9: 67,886,246 probably benign Het
Wls T A 3: 159,897,437 C162* probably null Het
Zbtb7c C T 18: 76,137,393 T184I probably benign Het
Zc3h13 A G 14: 75,308,965 K169E probably damaging Het
Other mutations in Olfr262
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Olfr262 APN 19 12241527 missense probably damaging 0.99
IGL02170:Olfr262 APN 19 12240756 missense probably benign
IGL02748:Olfr262 APN 19 12240840 missense probably benign 0.01
IGL02896:Olfr262 APN 19 12240989 nonsense probably null
R0365:Olfr262 UTSW 19 12241076 missense probably benign 0.13
R1226:Olfr262 UTSW 19 12241586 missense probably benign
R1319:Olfr262 UTSW 19 12241502 missense probably damaging 1.00
R1426:Olfr262 UTSW 19 12241182 missense possibly damaging 0.81
R1453:Olfr262 UTSW 19 12241592 missense probably benign
R1675:Olfr262 UTSW 19 12240831 missense probably benign 0.37
R1773:Olfr262 UTSW 19 12241659 start codon destroyed probably null 0.03
R1778:Olfr262 UTSW 19 12241455 missense probably benign
R1820:Olfr262 UTSW 19 12241248 missense probably damaging 1.00
R3161:Olfr262 UTSW 19 12241496 missense probably benign 0.06
R3412:Olfr262 UTSW 19 12241590 missense probably benign 0.00
R4387:Olfr262 UTSW 19 12241139 missense probably damaging 0.98
R4389:Olfr262 UTSW 19 12241139 missense probably damaging 0.98
R4782:Olfr262 UTSW 19 12241572 missense probably benign 0.01
R4885:Olfr262 UTSW 19 12240718 splice site probably null
R4915:Olfr262 UTSW 19 12241373 missense probably benign 0.31
R5254:Olfr262 UTSW 19 12241248 missense probably damaging 1.00
R5726:Olfr262 UTSW 19 12241280 missense probably damaging 0.99
R6579:Olfr262 UTSW 19 12241362 missense probably benign
R7062:Olfr262 UTSW 19 12240725 missense probably benign
R7424:Olfr262 UTSW 19 12240954 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TGGAGGAGCCACCAGAACTTGAAC -3'
(R):5'- GAGTGAGTCTTGTCTCATGGCAGC -3'

Sequencing Primer
(F):5'- TGAATGCCTTGGATCTGCC -3'
(R):5'- ATGGTGCTGGCATCCTATCT -3'
Posted On2013-05-23