Mutagenetix > Incidental Mutation

Incidental Mutation 'R5015:Sall2'

385532

Institutional Source

Beutler Lab

Gene Symbol

Sall2

Ensembl Gene

ENSMUSG00000049532

Gene Name

spalt like transcription factor 2

Synonyms

Msal-2

MMRRC Submission

042606-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5015 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

52311172-52328762 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 52315655 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 26 (S26R)

Ref Sequence

ENSEMBL: ENSMUSP00000154331 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058326] [ENSMUST00000135523]

AlphaFold

Q9QX96

Predicted Effect

possibly damaging
Transcript: ENSMUST00000058326
AA Change: S28R

PolyPhen 2 Score 0.560 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000056401
Gene: ENSMUSG00000049532
AA Change: S28R

Domain	Start	End	E-Value	Type
low complexity region	71	81	N/A	INTRINSIC
low complexity region	97	110	N/A	INTRINSIC
low complexity region	128	139	N/A	INTRINSIC
low complexity region	151	170	N/A	INTRINSIC
ZnF_C2H2	372	394	2.57e-3	SMART
ZnF_C2H2	400	422	1.28e-3	SMART
low complexity region	476	501	N/A	INTRINSIC
low complexity region	602	627	N/A	INTRINSIC
ZnF_C2H2	629	651	1.2e1	SMART
ZnF_C2H2	657	679	1.69e-3	SMART
ZnF_C2H2	689	711	6.88e-4	SMART
low complexity region	719	730	N/A	INTRINSIC
low complexity region	747	779	N/A	INTRINSIC
low complexity region	799	819	N/A	INTRINSIC
low complexity region	829	848	N/A	INTRINSIC
ZnF_C2H2	908	930	2.09e-3	SMART
ZnF_C2H2	937	960	1.01e-1	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000135523
AA Change: S26R

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)

Coding Region Coverage

1x: 98.3%
3x: 97.3%
10x: 95.2%
20x: 91.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple zinc finger domains. The encoded protein functions in optical fissure closure during development of the eye in the embryo. Mutations in this gene are associated with ocular coloboma. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in no apparent abnormal phenotypes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam25	T	A	8: 40,754,634	F312L	probably benign	Het
Adprm	A	G	11: 67,042,030	F18L	possibly damaging	Het
Ampd1	T	G	3: 103,099,665	N735K	possibly damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Atp1a4	T	C	1: 172,254,082	M168V	probably damaging	Het
Bcl6	G	A	16: 23,974,850	H116Y	probably damaging	Het
Bmpr2	T	A	1: 59,851,224	N338K	probably damaging	Het
Bms1	A	T	6: 118,404,263	Y697*	probably null	Het
Ccdc33	A	C	9: 58,118,635	F37C	probably damaging	Het
Ccdc60	T	A	5: 116,288,448	Q30L	probably benign	Het
Cndp1	C	A	18: 84,631,911	R219L	probably damaging	Het
D13Ertd608e	T	A	13: 119,836,938		probably null	Het
Daam2	C	A	17: 49,476,522	D627Y	probably damaging	Het
Dffb	T	C	4: 153,972,959	D87G	possibly damaging	Het
Dnah2	T	G	11: 69,497,882	T892P	possibly damaging	Het
Dqx1	A	G	6: 83,066,111	T610A	probably benign	Het
Dspp	A	T	5: 104,177,060	I430L	possibly damaging	Het
Dytn	T	A	1: 63,633,695	K516N	probably benign	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fmnl2	T	A	2: 53,103,761	N389K	possibly damaging	Het
Fn1	G	A	1: 71,626,177	T927I	probably damaging	Het
Foxn1	T	C	11: 78,371,163	K127E	probably damaging	Het
Fpr-rs6	A	G	17: 20,182,346	F251S	probably damaging	Het
Frrs1	A	G	3: 116,878,439	D62G	probably damaging	Het
Fut10	T	A	8: 31,236,120	V301D	probably damaging	Het
Gk5	A	G	9: 96,177,417		probably null	Het
Glipr1l1	T	A	10: 112,078,374	N213K	probably benign	Het
Gm1110	A	G	9: 26,881,866	F538S	probably benign	Het
Gm11492	C	T	11: 87,567,217	S139F	possibly damaging	Het
Gm5483	T	C	16: 36,186,467		probably null	Het
Gm7347	T	A	5: 26,057,368	T52S	probably benign	Het
Gsap	T	C	5: 21,222,408	I178T	probably damaging	Het
Hcn1	A	T	13: 117,603,020	Q106L	unknown	Het
Hils1	C	A	11: 94,968,102	N74K	probably damaging	Het
Isg20l2	G	T	3: 87,931,981	L166F	possibly damaging	Het
Kcnq3	T	A	15: 66,004,763	E510D	probably damaging	Het
Kif26b	G	T	1: 178,928,330	R2003L	probably damaging	Het
Kiss1r	T	C	10: 79,918,807	V45A	probably damaging	Het
Krt14	G	A	11: 100,207,206	R84*	probably null	Het
Mbd5	T	C	2: 49,258,196	M806T	possibly damaging	Het
Mdga1	A	T	17: 29,839,873	I13N	possibly damaging	Het
Mfsd4b5	T	C	10: 39,974,762	K73E	probably benign	Het
Mterf2	C	T	10: 85,119,732	G343R	probably benign	Het
Mto1	T	A	9: 78,461,621	F522I	probably benign	Het
Myo18b	T	C	5: 112,790,057	E1734G	probably damaging	Het
Myoz1	T	C	14: 20,653,719	T53A	probably benign	Het
Naxd	T	C	8: 11,513,032	L324P	probably damaging	Het
Nos1	T	A	5: 117,867,269	V18D	probably damaging	Het
Nova1	T	C	12: 46,816,955	T71A	unknown	Het
Olfr1417	T	C	19: 11,828,118	R303G	probably benign	Het
Olfr389	C	G	11: 73,777,181	V49L	probably benign	Het
Olfr419	A	G	1: 174,250,882	L15S	possibly damaging	Het
Olfr531	T	C	7: 140,400,170	D292G	probably damaging	Het
Olfr690	A	G	7: 105,329,604	V196A	possibly damaging	Het
Otof	T	A	5: 30,382,894	Y981F	probably damaging	Het
Peg10	C	CTCA	6: 4,756,453		probably benign	Het
Pex1	A	G	5: 3,620,597	K7E	probably damaging	Het
Pi4ka	A	G	16: 17,303,082	S73P	possibly damaging	Het
Plxnb1	T	A	9: 109,100,430	I118N	possibly damaging	Het
Prcc	T	C	3: 87,872,253	D158G	probably damaging	Het
Ptpn7	C	A	1: 135,139,139	R245S	possibly damaging	Het
Ptpre	C	T	7: 135,669,132	H346Y	probably benign	Het
Pwp2	A	G	10: 78,182,693	C86R	probably benign	Het
Rfng	T	G	11: 120,783,050	D178A	probably damaging	Het
Rhpn1	T	C	15: 75,708,241	I51T	probably damaging	Het
Rnasel	G	T	1: 153,754,097	E120*	probably null	Het
Scn10a	A	G	9: 119,622,921	V1312A	possibly damaging	Het
Sdk2	C	A	11: 113,793,761	R1958L	probably damaging	Het
Slc52a2	T	A	15: 76,540,551	C330S	probably damaging	Het
Smarca2	T	A	19: 26,691,388	I987N	possibly damaging	Het
Srrt	A	T	5: 137,296,009	Y486N	probably damaging	Het
Stat5b	A	T	11: 100,805,005	N50K	possibly damaging	Het
Strip2	T	A	6: 29,931,266	D405E	probably benign	Het
Tnc	A	T	4: 64,006,502	D986E	probably damaging	Het
Tph2	T	C	10: 115,079,716	N473S	probably benign	Het
Tpp1	C	T	7: 105,752,025		probably benign	Het
Trpm3	T	C	19: 22,711,712	Y2H	probably damaging	Het
Ttc21a	A	T	9: 119,966,129	E1072V	probably damaging	Het
Zfat	T	C	15: 68,178,913	D753G	probably damaging	Het
Zmym2	T	A	14: 56,921,594	S609T	probably damaging	Het

Other mutations in Sall2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01587:Sall2	APN	14	52314571	missense	probably damaging	1.00
IGL02152:Sall2	APN	14	52315514	missense	probably damaging	1.00
IGL02318:Sall2	APN	14	52315565	missense	probably damaging	1.00
IGL02933:Sall2	APN	14	52313027	missense	probably benign	0.00
IGL03165:Sall2	APN	14	52314168	missense	probably damaging	1.00
R1079:Sall2	UTSW	14	52313203	missense	probably benign	0.13
R1295:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1674:Sall2	UTSW	14	52313836	missense	probably damaging	1.00
R1840:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1989:Sall2	UTSW	14	52314439	missense	probably damaging	1.00
R2339:Sall2	UTSW	14	52313356	missense	probably damaging	1.00
R3407:Sall2	UTSW	14	52328104	missense	probably benign	0.03
R3870:Sall2	UTSW	14	52313994	missense	probably damaging	1.00
R3895:Sall2	UTSW	14	52314047	missense	probably damaging	0.99
R4059:Sall2	UTSW	14	52314571	missense	probably damaging	1.00
R4272:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4273:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4275:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4289:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4503:Sall2	UTSW	14	52313459	missense	probably benign
R4592:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4611:Sall2	UTSW	14	52313753	missense	probably damaging	1.00
R4615:Sall2	UTSW	14	52312750	missense	probably benign	0.20
R4640:Sall2	UTSW	14	52315159	missense	probably damaging	0.99
R4693:Sall2	UTSW	14	52314478	missense	probably damaging	1.00
R4921:Sall2	UTSW	14	52315393	missense	possibly damaging	0.93
R5007:Sall2	UTSW	14	52314493	missense	probably damaging	1.00
R5079:Sall2	UTSW	14	52314754	missense	probably damaging	1.00
R5419:Sall2	UTSW	14	52313129	missense	probably damaging	1.00
R5849:Sall2	UTSW	14	52314247	missense	probably benign	0.13
R6229:Sall2	UTSW	14	52313191	missense	probably benign
R6397:Sall2	UTSW	14	52315153	missense	probably damaging	1.00
R6422:Sall2	UTSW	14	52312724	makesense	probably null
R6456:Sall2	UTSW	14	52313593	missense	probably damaging	1.00
R6456:Sall2	UTSW	14	52313594	nonsense	probably null
R6786:Sall2	UTSW	14	52314621	missense	probably damaging	1.00
R7293:Sall2	UTSW	14	52314411	nonsense	probably null
R7496:Sall2	UTSW	14	52315561	missense	possibly damaging	0.63
R7792:Sall2	UTSW	14	52316064	missense	probably damaging	1.00
R8324:Sall2	UTSW	14	52312886	missense	probably benign	0.30
R9017:Sall2	UTSW	14	52313262	missense	possibly damaging	0.51
R9149:Sall2	UTSW	14	52313216	missense	possibly damaging	0.95
R9362:Sall2	UTSW	14	52313144	nonsense	probably null
R9571:Sall2	UTSW	14	52314373	missense	probably damaging	1.00
R9574:Sall2	UTSW	14	52314160	missense	probably damaging	1.00
R9641:Sall2	UTSW	14	52313425	missense	probably damaging	1.00
R9648:Sall2	UTSW	14	52313767	missense	probably damaging	1.00
R9694:Sall2	UTSW	14	52314667	missense	possibly damaging	0.63

Predicted Primers

PCR Primer
(F):5'- ATCCATGACCTGGGACCTAC -3'
(R):5'- TGATTCTGCACATAGGCCCC -3'

Sequencing Primer
(F):5'- ATGACCTGGGACCTACTGTGG -3'
(R):5'- AACCCCCGTTTTGCTGGG -3'

Posted On

2016-05-10