Incidental Mutation 'R5016:Rasd2'
ID385580
Institutional Source Beutler Lab
Gene Symbol Rasd2
Ensembl Gene ENSMUSG00000034472
Gene NameRASD family, member 2
Synonyms4930526B11Rik, Rhes, TEM-2, TEM2
MMRRC Submission 042607-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R5016 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location75213944-75224113 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 75221975 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 176 (N176K)
Ref Sequence ENSEMBL: ENSMUSP00000118070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000132133] [ENSMUST00000139848]
Predicted Effect probably damaging
Transcript: ENSMUST00000132133
AA Change: N176K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120717
Gene: ENSMUSG00000034472
AA Change: N176K

DomainStartEndE-ValueType
RAS 17 193 6.46e-73 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000139848
AA Change: N176K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118070
Gene: ENSMUSG00000034472
AA Change: N176K

DomainStartEndE-ValueType
RAS 17 193 6.46e-73 SMART
Meta Mutation Damage Score 0.4859 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 91.0%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the Ras superfamily of small GTPases and is enriched in the striatum. The encoded protein functions as an E3 ligase for attachment of small ubiquitin-like modifier (SUMO). This protein also binds to mutant huntingtin (mHtt), the protein mutated in Huntington disease (HD). Sumoylation of mHTT by this protein may cause degeneration of the striatum. The protein functions as an activator of mechanistic target of rapamycin 1 (mTOR1), which in turn plays a role in myelination, axon growth and regeneration. Reduced levels of mRNA expressed by this gene were found in HD patients. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display reduced body weight, impaired motor coordination, hypoactivity, and a gender-dependent increase in anxiety levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,671,268 P768S probably damaging Het
Adprhl1 A G 8: 13,224,889 L623P possibly damaging Het
Anapc1 A T 2: 128,607,175 probably benign Het
Ankzf1 C A 1: 75,195,978 probably benign Het
Ash1l A G 3: 88,982,323 D503G probably damaging Het
Atp7b T C 8: 22,015,869 probably null Het
Bach1 T A 16: 87,719,318 V249D possibly damaging Het
Ccdc158 A G 5: 92,657,892 S335P probably benign Het
Chd9 T A 8: 91,006,626 C1374* probably null Het
Col16a1 C T 4: 130,079,195 T643M probably benign Het
Cygb A G 11: 116,650,014 F49L probably benign Het
Dnah17 G C 11: 118,080,766 T2147S probably damaging Het
Drd3 C A 16: 43,762,246 A34E possibly damaging Het
Ephb6 G A 6: 41,618,107 R685Q probably benign Het
Ezh1 G A 11: 101,199,237 probably benign Het
Gpr19 T A 6: 134,869,917 K231* probably null Het
Gpr61 A G 3: 108,150,667 V226A possibly damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hnrnpul2 A G 19: 8,822,825 K185R possibly damaging Het
Igsf9 A C 1: 172,490,712 T140P probably damaging Het
Ksr2 A G 5: 117,500,792 D87G probably benign Het
Llgl2 A G 11: 115,853,424 E843G probably damaging Het
Ltbp4 GT G 7: 27,327,685 probably null Het
Luc7l2 A G 6: 38,585,101 I20V possibly damaging Het
Mcm6 G A 1: 128,343,427 T485M probably damaging Het
Miox A G 15: 89,335,564 D85G probably null Het
Nudt18 T C 14: 70,579,463 F169S probably benign Het
Nxpe4 A G 9: 48,392,885 N91D probably benign Het
Olfr1089 T G 2: 86,732,746 I289L probably benign Het
Olfr155 T C 4: 43,854,596 S96P probably benign Het
Olfr811 A G 10: 129,801,793 V244A probably benign Het
Pdss2 G T 10: 43,222,005 A82S probably damaging Het
Ptprs T C 17: 56,419,070 D998G probably damaging Het
Serpinb3a A G 1: 107,046,330 F284L probably damaging Het
Skint6 T A 4: 113,171,533 probably null Het
Slc12a6 C T 2: 112,356,627 probably benign Het
Slc22a19 G A 19: 7,674,372 T490M probably benign Het
Sp2 A T 11: 96,955,832 C562S probably damaging Het
Specc1 A G 11: 62,118,957 E433G possibly damaging Het
Sspo C T 6: 48,452,280 Q451* probably null Het
St6galnac1 A T 11: 116,765,880 S478T probably damaging Het
Steap4 C T 5: 7,976,699 R221* probably null Het
Ugt1a5 C G 1: 88,166,241 R64G probably benign Het
Vmn1r202 A T 13: 22,502,205 F14Y probably damaging Het
Vmn2r79 T C 7: 87,037,340 V643A probably benign Het
Vmn2r91 C A 17: 18,110,060 Y535* probably null Het
Wdr3 A T 3: 100,141,620 probably benign Het
Wdr95 T C 5: 149,544,801 M41T probably benign Het
Other mutations in Rasd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02874:Rasd2 APN 8 75218699 missense probably damaging 1.00
R3924:Rasd2 UTSW 8 75221974 missense probably damaging 1.00
R4254:Rasd2 UTSW 8 75221910 missense probably damaging 0.99
R4255:Rasd2 UTSW 8 75221910 missense probably damaging 0.99
R4664:Rasd2 UTSW 8 75221928 missense possibly damaging 0.88
R5006:Rasd2 UTSW 8 75218606 missense probably damaging 1.00
R5052:Rasd2 UTSW 8 75221936 missense possibly damaging 0.89
R5951:Rasd2 UTSW 8 75222183 missense probably damaging 1.00
R7524:Rasd2 UTSW 8 75222081 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGTCAAGTCCTGCCTGAAG -3'
(R):5'- GACCTTGGCCTTGATGTACTTG -3'

Sequencing Primer
(F):5'- GTCAAGTCCTGCCTGAAGAATAAAAC -3'
(R):5'- TCACTGTTGACACTGGGGC -3'
Posted On2016-05-10