Incidental Mutation 'R5016:Pdss2'
ID385583
Institutional Source Beutler Lab
Gene Symbol Pdss2
Ensembl Gene ENSMUSG00000038240
Gene Nameprenyl (solanesyl) diphosphate synthase, subunit 2
Synonyms5430420P03Rik, kd, mDLP1, PLMP
MMRRC Submission 042607-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5016 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location43221486-43464882 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 43222005 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 82 (A82S)
Ref Sequence ENSEMBL: ENSMUSP00000124046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095725] [ENSMUST00000159139] [ENSMUST00000160823]
Predicted Effect probably damaging
Transcript: ENSMUST00000095725
AA Change: A82S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093393
Gene: ENSMUSG00000038240
AA Change: A82S

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 32 46 N/A INTRINSIC
Pfam:polyprenyl_synt 106 324 9e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159139
AA Change: A82S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124864
Gene: ENSMUSG00000038240
AA Change: A82S

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 32 46 N/A INTRINSIC
Pfam:polyprenyl_synt 103 323 7.9e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160108
Predicted Effect probably damaging
Transcript: ENSMUST00000160823
AA Change: A82S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124046
Gene: ENSMUSG00000038240
AA Change: A82S

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 32 46 N/A INTRINSIC
Pfam:polyprenyl_synt 103 319 7.4e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162758
Meta Mutation Damage Score 0.3124 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 91.0%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzyme that synthesizes the prenyl side-chain of coenzyme Q, or ubiquinone, one of the key elements in the respiratory chain. The gene product catalyzes the formation of all trans-polyprenyl pyrophosphates from isopentyl diphosphate in the assembly of polyisoprenoid side chains, the first step in coenzyme Q biosynthesis. Defects in this gene are a cause of coenzyme Q10 deficiency.[provided by RefSeq, Oct 2009]
PHENOTYPE: Mutations in this gene result in renal abnormalities leading to early death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,671,268 P768S probably damaging Het
Adprhl1 A G 8: 13,224,889 L623P possibly damaging Het
Anapc1 A T 2: 128,607,175 probably benign Het
Ankzf1 C A 1: 75,195,978 probably benign Het
Ash1l A G 3: 88,982,323 D503G probably damaging Het
Atp7b T C 8: 22,015,869 probably null Het
Bach1 T A 16: 87,719,318 V249D possibly damaging Het
Ccdc158 A G 5: 92,657,892 S335P probably benign Het
Chd9 T A 8: 91,006,626 C1374* probably null Het
Col16a1 C T 4: 130,079,195 T643M probably benign Het
Cygb A G 11: 116,650,014 F49L probably benign Het
Dnah17 G C 11: 118,080,766 T2147S probably damaging Het
Drd3 C A 16: 43,762,246 A34E possibly damaging Het
Ephb6 G A 6: 41,618,107 R685Q probably benign Het
Ezh1 G A 11: 101,199,237 probably benign Het
Gpr19 T A 6: 134,869,917 K231* probably null Het
Gpr61 A G 3: 108,150,667 V226A possibly damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hnrnpul2 A G 19: 8,822,825 K185R possibly damaging Het
Igsf9 A C 1: 172,490,712 T140P probably damaging Het
Ksr2 A G 5: 117,500,792 D87G probably benign Het
Llgl2 A G 11: 115,853,424 E843G probably damaging Het
Ltbp4 GT G 7: 27,327,685 probably null Het
Luc7l2 A G 6: 38,585,101 I20V possibly damaging Het
Mcm6 G A 1: 128,343,427 T485M probably damaging Het
Miox A G 15: 89,335,564 D85G probably null Het
Nudt18 T C 14: 70,579,463 F169S probably benign Het
Nxpe4 A G 9: 48,392,885 N91D probably benign Het
Olfr1089 T G 2: 86,732,746 I289L probably benign Het
Olfr155 T C 4: 43,854,596 S96P probably benign Het
Olfr811 A G 10: 129,801,793 V244A probably benign Het
Ptprs T C 17: 56,419,070 D998G probably damaging Het
Rasd2 C A 8: 75,221,975 N176K probably damaging Het
Serpinb3a A G 1: 107,046,330 F284L probably damaging Het
Skint6 T A 4: 113,171,533 probably null Het
Slc12a6 C T 2: 112,356,627 probably benign Het
Slc22a19 G A 19: 7,674,372 T490M probably benign Het
Sp2 A T 11: 96,955,832 C562S probably damaging Het
Specc1 A G 11: 62,118,957 E433G possibly damaging Het
Sspo C T 6: 48,452,280 Q451* probably null Het
St6galnac1 A T 11: 116,765,880 S478T probably damaging Het
Steap4 C T 5: 7,976,699 R221* probably null Het
Ugt1a5 C G 1: 88,166,241 R64G probably benign Het
Vmn1r202 A T 13: 22,502,205 F14Y probably damaging Het
Vmn2r79 T C 7: 87,037,340 V643A probably benign Het
Vmn2r91 C A 17: 18,110,060 Y535* probably null Het
Wdr3 A T 3: 100,141,620 probably benign Het
Wdr95 T C 5: 149,544,801 M41T probably benign Het
Other mutations in Pdss2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02346:Pdss2 APN 10 43345643 missense possibly damaging 0.80
IGL03337:Pdss2 APN 10 43345593 missense probably damaging 1.00
IGL03340:Pdss2 APN 10 43394001 missense probably benign 0.00
R0277:Pdss2 UTSW 10 43372176 missense probably benign
R0323:Pdss2 UTSW 10 43372176 missense probably benign
R0324:Pdss2 UTSW 10 43393928 missense probably damaging 1.00
R0508:Pdss2 UTSW 10 43221931 small deletion probably benign
R0654:Pdss2 UTSW 10 43221931 small deletion probably benign
R1472:Pdss2 UTSW 10 43413537 missense probably benign 0.00
R1801:Pdss2 UTSW 10 43345605 missense probably benign 0.29
R2024:Pdss2 UTSW 10 43393875 missense possibly damaging 0.81
R2025:Pdss2 UTSW 10 43393875 missense possibly damaging 0.81
R2026:Pdss2 UTSW 10 43393875 missense possibly damaging 0.81
R4077:Pdss2 UTSW 10 43402522 missense probably benign
R4079:Pdss2 UTSW 10 43402522 missense probably benign
R4292:Pdss2 UTSW 10 43221838 missense probably benign
R4518:Pdss2 UTSW 10 43372150 missense probably damaging 0.99
R4603:Pdss2 UTSW 10 43372201 missense probably damaging 0.99
R4962:Pdss2 UTSW 10 43298912 missense possibly damaging 0.47
R5610:Pdss2 UTSW 10 43439832 missense probably benign 0.00
R5888:Pdss2 UTSW 10 43221797 synonymous silent
R5972:Pdss2 UTSW 10 43298926 missense probably damaging 0.99
R7246:Pdss2 UTSW 10 43372176 missense probably benign
R7697:Pdss2 UTSW 10 43345548 missense probably damaging 1.00
R7765:Pdss2 UTSW 10 43464632 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TACTTCAGATCCCTCGACAGC -3'
(R):5'- AGCCATGAAGCATCTGCATC -3'

Sequencing Primer
(F):5'- TCGACAGCATCTCCTCGG -3'
(R):5'- TTACGAAAACCATTTATCCTGGGCC -3'
Posted On2016-05-10