Incidental Mutation 'R0423:A630001G21Rik'
Institutional Source Beutler Lab
Gene Symbol A630001G21Rik
Ensembl Gene ENSMUSG00000052760
Gene NameRIKEN cDNA A630001G21 gene
MMRRC Submission 038625-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R0423 (G1)
Quality Score206
Status Validated
Chromosomal Location85717083-85778643 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85726466 bp
Amino Acid Change Isoleucine to Threonine at position 50 (I50T)
Ref Sequence ENSEMBL: ENSMUSP00000124137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064788] [ENSMUST00000159122] [ENSMUST00000162038]
Predicted Effect probably benign
Transcript: ENSMUST00000064788
AA Change: I50T

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000070374
Gene: ENSMUSG00000052760
AA Change: I50T

Pfam:Sp100 11 109 3.1e-40 PFAM
low complexity region 168 187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159122
AA Change: I50T

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000124137
Gene: ENSMUSG00000052760
AA Change: I50T

Pfam:Sp100 9 112 8.3e-45 PFAM
low complexity region 168 187 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161453
Predicted Effect probably benign
Transcript: ENSMUST00000162038
AA Change: I50T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000125643
Gene: ENSMUSG00000052760
AA Change: I50T

Pfam:Sp100 11 109 4e-41 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.9%
Validation Efficiency 99% (84/85)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik T C 2: 28,466,024 probably benign Het
4930432E11Rik A T 7: 29,562,400 noncoding transcript Het
Abhd12 T C 2: 150,838,392 T264A possibly damaging Het
Acsm3 T C 7: 119,777,159 Y370H probably damaging Het
Ank2 G T 3: 126,929,860 Y3789* probably null Het
Anxa4 C T 6: 86,760,737 A1T probably damaging Het
Apba1 T A 19: 23,944,998 V810D probably damaging Het
Bank1 A G 3: 136,284,017 I104T possibly damaging Het
Birc6 T C 17: 74,696,297 Y4721H probably damaging Het
Bmpr2 A G 1: 59,868,510 T921A probably benign Het
Ccdc102a A C 8: 94,905,926 probably benign Het
Ccdc141 C A 2: 77,039,450 D904Y probably damaging Het
Ccdc96 A G 5: 36,485,247 K199R probably benign Het
Cdh10 G A 15: 18,986,879 V399I probably benign Het
Cenpk A G 13: 104,234,225 T85A probably benign Het
Col6a2 A C 10: 76,614,917 V60G possibly damaging Het
Cops7b A G 1: 86,599,031 D119G probably benign Het
Cstf2t A G 19: 31,084,276 E404G possibly damaging Het
Ctnna2 A T 6: 77,653,069 V134E probably damaging Het
Cwh43 A C 5: 73,416,742 M250L probably benign Het
D17Wsu92e A C 17: 27,786,233 Y117D probably damaging Het
Daam2 T A 17: 49,469,421 K813* probably null Het
Dhcr24 G A 4: 106,586,536 probably benign Het
Dnah8 G T 17: 30,701,981 R1182L probably benign Het
Doc2a C T 7: 126,848,658 P25S probably damaging Het
Dst A G 1: 34,278,035 S6823G possibly damaging Het
Espl1 T A 15: 102,303,986 L509* probably null Het
Fbxw19 C T 9: 109,486,066 V143I probably benign Het
Fbxw5 A G 2: 25,504,526 T171A possibly damaging Het
Gfra2 C T 14: 70,896,081 T117M probably damaging Het
Gm454 T A 5: 138,204,141 noncoding transcript Het
Kcnq4 A G 4: 120,717,508 S120P probably damaging Het
Krt84 A T 15: 101,528,720 L336Q probably damaging Het
Lilra6 T A 7: 3,914,775 probably benign Het
Mbnl2 G A 14: 120,325,324 R29H probably damaging Het
Mcm3ap G A 10: 76,502,705 G1389D probably benign Het
Mettl13 A T 1: 162,544,385 I305N probably damaging Het
Muc6 A G 7: 141,652,283 S30P probably benign Het
Myh7 T A 14: 54,979,189 Q1237L probably benign Het
Myo9a T G 9: 59,895,336 D2035E probably damaging Het
Nat10 A G 2: 103,748,227 S211P probably damaging Het
Ntm T C 9: 29,179,099 Y108C probably damaging Het
Olfr292 T C 7: 86,695,226 Y257H possibly damaging Het
Olfr843 A T 9: 19,248,952 L149* probably null Het
Pcdhb16 A G 18: 37,480,369 D794G probably benign Het
Phlpp1 A G 1: 106,339,615 T753A probably benign Het
Pnldc1 T C 17: 12,890,076 Q511R possibly damaging Het
Ppip5k2 A G 1: 97,761,427 S38P possibly damaging Het
Pygb A G 2: 150,823,984 K593E probably benign Het
Rangap1 A T 15: 81,705,463 F564I probably damaging Het
Rictor A T 15: 6,773,900 I498F possibly damaging Het
Rnase12 A T 14: 51,057,156 V22D probably benign Het
Rpl7l1 T A 17: 46,780,398 M93L probably benign Het
Smg1 T C 7: 118,176,880 R1396G possibly damaging Het
Snx19 C A 9: 30,435,837 T692N probably damaging Het
Spag6 A G 2: 18,710,593 D61G probably benign Het
Spen T A 4: 141,479,336 N660I unknown Het
Sptan1 T G 2: 30,028,672 C2246G probably null Het
Svopl A G 6: 38,036,707 probably benign Het
Taf2 A T 15: 55,064,682 N108K probably benign Het
Thbs4 T C 13: 92,756,571 D703G probably damaging Het
Tle6 G T 10: 81,598,623 N47K possibly damaging Het
Usp48 G T 4: 137,616,411 V452L probably benign Het
Ust A T 10: 8,298,148 S198T probably damaging Het
Wnk2 T A 13: 49,095,418 M386L possibly damaging Het
Ywhaq T C 12: 21,391,381 probably benign Het
Zfp11 C T 5: 129,658,238 G53E possibly damaging Het
Zfp316 A G 5: 143,253,238 S1009P probably damaging Het
Zfp963 A G 8: 69,744,506 Y29H probably damaging Het
Zmym4 A G 4: 126,882,319 probably benign Het
Zranb3 A G 1: 128,091,870 I45T probably damaging Het
Other mutations in A630001G21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02572:A630001G21Rik APN 1 85725171 missense probably damaging 0.96
FR4737:A630001G21Rik UTSW 1 85723135 utr 3 prime probably benign
PIT4469001:A630001G21Rik UTSW 1 85725199 missense probably benign 0.00
R3029:A630001G21Rik UTSW 1 85718245 missense probably benign 0.33
R4417:A630001G21Rik UTSW 1 85726463 missense probably damaging 0.98
R4876:A630001G21Rik UTSW 1 85719040 missense probably damaging 0.98
R5592:A630001G21Rik UTSW 1 85726611 missense probably damaging 0.96
R5719:A630001G21Rik UTSW 1 85723385 missense probably benign 0.01
R5780:A630001G21Rik UTSW 1 85718318 missense probably benign 0.02
X0020:A630001G21Rik UTSW 1 85725259 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tcagtggataagagcagtcag -3'
Posted On2013-05-23