Incidental Mutation 'R5016:Bach1'
ID385597
Institutional Source Beutler Lab
Gene Symbol Bach1
Ensembl Gene ENSMUSG00000025612
Gene NameBTB and CNC homology 1, basic leucine zipper transcription factor 1
Synonyms
MMRRC Submission 042607-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5016 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location87698945-87733346 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87719318 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 249 (V249D)
Ref Sequence ENSEMBL: ENSMUSP00000026703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026703]
PDB Structure
Structure of mouse Bach1 BTB domain [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026703
AA Change: V249D

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026703
Gene: ENSMUSG00000025612
AA Change: V249D

DomainStartEndE-ValueType
BTB 34 130 1.23e-24 SMART
Blast:BTB 153 235 2e-29 BLAST
low complexity region 378 390 N/A INTRINSIC
low complexity region 504 517 N/A INTRINSIC
BRLZ 556 622 1.2e-12 SMART
low complexity region 699 717 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151046
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156958
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 91.0%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that belongs to the cap'n'collar type of basic region leucine zipper factor family (CNC-bZip). The encoded protein contains broad complex, tramtrack, bric-a-brac/poxvirus and zinc finger (BTB/POZ) domains, which is atypical of CNC-bZip family members. These BTB/POZ domains facilitate protein-protein interactions and formation of homo- and/or hetero-oligomers. When this encoded protein forms a heterodimer with MafK, it functions as a repressor of Maf recognition element (MARE) and transcription is repressed. Multiple alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mice are healthy and fertile with no gross abnormalities but express elevated levels of HMOX1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,671,268 P768S probably damaging Het
Adprhl1 A G 8: 13,224,889 L623P possibly damaging Het
Anapc1 A T 2: 128,607,175 probably benign Het
Ankzf1 C A 1: 75,195,978 probably benign Het
Ash1l A G 3: 88,982,323 D503G probably damaging Het
Atp7b T C 8: 22,015,869 probably null Het
Ccdc158 A G 5: 92,657,892 S335P probably benign Het
Chd9 T A 8: 91,006,626 C1374* probably null Het
Col16a1 C T 4: 130,079,195 T643M probably benign Het
Cygb A G 11: 116,650,014 F49L probably benign Het
Dnah17 G C 11: 118,080,766 T2147S probably damaging Het
Drd3 C A 16: 43,762,246 A34E possibly damaging Het
Ephb6 G A 6: 41,618,107 R685Q probably benign Het
Ezh1 G A 11: 101,199,237 probably benign Het
Gpr19 T A 6: 134,869,917 K231* probably null Het
Gpr61 A G 3: 108,150,667 V226A possibly damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hnrnpul2 A G 19: 8,822,825 K185R possibly damaging Het
Igsf9 A C 1: 172,490,712 T140P probably damaging Het
Ksr2 A G 5: 117,500,792 D87G probably benign Het
Llgl2 A G 11: 115,853,424 E843G probably damaging Het
Ltbp4 GT G 7: 27,327,685 probably null Het
Luc7l2 A G 6: 38,585,101 I20V possibly damaging Het
Mcm6 G A 1: 128,343,427 T485M probably damaging Het
Miox A G 15: 89,335,564 D85G probably null Het
Nudt18 T C 14: 70,579,463 F169S probably benign Het
Nxpe4 A G 9: 48,392,885 N91D probably benign Het
Olfr1089 T G 2: 86,732,746 I289L probably benign Het
Olfr155 T C 4: 43,854,596 S96P probably benign Het
Olfr811 A G 10: 129,801,793 V244A probably benign Het
Pdss2 G T 10: 43,222,005 A82S probably damaging Het
Ptprs T C 17: 56,419,070 D998G probably damaging Het
Rasd2 C A 8: 75,221,975 N176K probably damaging Het
Serpinb3a A G 1: 107,046,330 F284L probably damaging Het
Skint6 T A 4: 113,171,533 probably null Het
Slc12a6 C T 2: 112,356,627 probably benign Het
Slc22a19 G A 19: 7,674,372 T490M probably benign Het
Sp2 A T 11: 96,955,832 C562S probably damaging Het
Specc1 A G 11: 62,118,957 E433G possibly damaging Het
Sspo C T 6: 48,452,280 Q451* probably null Het
St6galnac1 A T 11: 116,765,880 S478T probably damaging Het
Steap4 C T 5: 7,976,699 R221* probably null Het
Ugt1a5 C G 1: 88,166,241 R64G probably benign Het
Vmn1r202 A T 13: 22,502,205 F14Y probably damaging Het
Vmn2r79 T C 7: 87,037,340 V643A probably benign Het
Vmn2r91 C A 17: 18,110,060 Y535* probably null Het
Wdr3 A T 3: 100,141,620 probably benign Het
Wdr95 T C 5: 149,544,801 M41T probably benign Het
Other mutations in Bach1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01553:Bach1 APN 16 87722505 missense probably damaging 1.00
R0626:Bach1 UTSW 16 87729471 missense possibly damaging 0.94
R0701:Bach1 UTSW 16 87719989 missense probably damaging 0.99
R1070:Bach1 UTSW 16 87720121 missense probably benign 0.02
R1160:Bach1 UTSW 16 87715434 missense probably benign 0.34
R2066:Bach1 UTSW 16 87729625 missense probably damaging 0.99
R2235:Bach1 UTSW 16 87720113 missense probably damaging 1.00
R4716:Bach1 UTSW 16 87715379 start gained probably benign
R4801:Bach1 UTSW 16 87722452 missense probably damaging 0.99
R4802:Bach1 UTSW 16 87722452 missense probably damaging 0.99
R4989:Bach1 UTSW 16 87719000 missense possibly damaging 0.94
R5527:Bach1 UTSW 16 87719545 missense probably benign 0.01
R5657:Bach1 UTSW 16 87719285 missense probably benign 0.00
R6064:Bach1 UTSW 16 87729864 missense probably damaging 1.00
R6384:Bach1 UTSW 16 87719857 nonsense probably null
R7009:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7027:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7028:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7029:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7030:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7095:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7096:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7192:Bach1 UTSW 16 87729663 missense possibly damaging 0.71
R7385:Bach1 UTSW 16 87729497 missense probably damaging 0.99
R7571:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7572:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7623:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7632:Bach1 UTSW 16 87720143 missense probably benign 0.00
R7714:Bach1 UTSW 16 87718848 nonsense probably null
R7715:Bach1 UTSW 16 87719971 missense possibly damaging 0.82
R7746:Bach1 UTSW 16 87729633 missense probably benign 0.00
R7896:Bach1 UTSW 16 87719005 missense possibly damaging 0.63
R7979:Bach1 UTSW 16 87719005 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GAAACGTGTTCAGACGCCTC -3'
(R):5'- AATCCTGAGGCAAGGGTGTC -3'

Sequencing Primer
(F):5'- TGTTCAGACGCCTCAGTGTGAC -3'
(R):5'- TCCCTTGGGGCTGCTCTG -3'
Posted On2016-05-10