Incidental Mutation 'R5017:Hapln2'
ID385605
Institutional Source Beutler Lab
Gene Symbol Hapln2
Ensembl Gene ENSMUSG00000004894
Gene Namehyaluronan and proteoglycan link protein 2
Synonyms4930401E20Rik, Bral1
MMRRC Submission 042608-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R5017 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location88021750-88027583 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88024001 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 69 (V69A)
Ref Sequence ENSEMBL: ENSMUSP00000005014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005014] [ENSMUST00000160150]
Predicted Effect probably damaging
Transcript: ENSMUST00000005014
AA Change: V69A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000005014
Gene: ENSMUSG00000004894
AA Change: V69A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
IGv 53 131 1.43e-8 SMART
LINK 147 243 4.25e-44 SMART
LINK 247 339 9.41e-37 SMART
Predicted Effect unknown
Transcript: ENSMUST00000160150
AA Change: Y33H
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160737
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162352
Meta Mutation Damage Score 0.5227 question?
Coding Region Coverage
  • 1x: 98.1%
  • 3x: 97.0%
  • 10x: 94.3%
  • 20x: 87.9%
Validation Efficiency 96% (46/48)
MGI Phenotype PHENOTYPE: Homozygous null mice display reduced nerve conduction velocity and abnormalities in the neuronal extracellular matrix. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,296,676 F167I unknown Het
Adamdec1 T C 14: 68,573,245 D154G probably benign Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Arhgef3 G T 14: 27,265,530 R20L possibly damaging Het
Birc2 A T 9: 7,818,885 C568* probably null Het
Cep44 A G 8: 56,544,207 S99P possibly damaging Het
Clstn2 A G 9: 97,483,086 W456R probably damaging Het
Cog5 T A 12: 31,920,605 S783T probably benign Het
Endod1 G A 9: 14,356,891 R433* probably null Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gdpd4 C A 7: 98,004,275 Y498* probably null Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Ifit3 A C 19: 34,587,192 N46T possibly damaging Het
Kcnh8 T C 17: 52,893,930 L464S probably damaging Het
Lrrc9 C A 12: 72,506,325 R1334S possibly damaging Het
Macf1 A G 4: 123,452,113 F2631L probably damaging Het
Mafa T C 15: 75,747,489 H145R probably benign Het
Muc6 T C 7: 141,640,528 T1411A probably benign Het
Nos3 A G 5: 24,366,719 probably benign Het
Nwd2 T A 5: 63,650,141 probably benign Het
Olfr160 A T 9: 37,711,525 Y251* probably null Het
Olfr44 A T 9: 39,484,755 M166K possibly damaging Het
Olfr981 A T 9: 40,022,376 probably benign Het
Pde11a A T 2: 76,136,367 D579E probably benign Het
Phkb A T 8: 86,049,809 H954L probably benign Het
Phldb3 C T 7: 24,620,096 T353M probably damaging Het
Pigu A T 2: 155,299,208 probably null Het
Pla2r1 A G 2: 60,522,760 probably null Het
Polr1c G T 17: 46,247,709 probably benign Het
Setbp1 C A 18: 78,856,594 G1286V possibly damaging Het
Siglecg T A 7: 43,411,386 probably benign Het
Slc25a46 A T 18: 31,605,783 H118Q probably damaging Het
Sycp1 A T 3: 102,895,987 probably null Het
Tmem132c A G 5: 127,563,350 T862A probably benign Het
Tmem256 T C 11: 69,838,992 probably benign Het
Tpr A T 1: 150,398,637 E98D probably benign Het
Trdn A G 10: 33,468,159 D623G probably benign Het
Trip11 T C 12: 101,846,620 N1485S probably benign Het
Trpm1 T C 7: 64,244,832 probably benign Het
Uhrf1bp1 T A 17: 27,894,739 L1295* probably null Het
Vmn1r227 T C 17: 20,736,078 noncoding transcript Het
Xpo6 G A 7: 126,104,747 A21V probably benign Het
Zfp276 A G 8: 123,264,977 probably benign Het
Other mutations in Hapln2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Hapln2 APN 3 88024334 missense possibly damaging 0.82
IGL01644:Hapln2 APN 3 88022637 missense probably damaging 0.99
IGL03177:Hapln2 APN 3 88022771 missense probably damaging 1.00
R0349:Hapln2 UTSW 3 88023629 missense probably damaging 1.00
R1546:Hapln2 UTSW 3 88024097 missense probably benign 0.01
R1791:Hapln2 UTSW 3 88024405 missense possibly damaging 0.66
R1842:Hapln2 UTSW 3 88024001 missense probably damaging 1.00
R1922:Hapln2 UTSW 3 88023377 missense probably benign 0.22
R1970:Hapln2 UTSW 3 88024120 critical splice acceptor site probably null
R2152:Hapln2 UTSW 3 88023613 missense probably benign 0.21
R6190:Hapln2 UTSW 3 88023293 missense probably damaging 1.00
R6852:Hapln2 UTSW 3 88022651 missense possibly damaging 0.61
R6910:Hapln2 UTSW 3 88023828 missense probably damaging 1.00
R7585:Hapln2 UTSW 3 88022673 missense probably damaging 1.00
R8270:Hapln2 UTSW 3 88023544 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGCCATTGATGAGCTCGCAG -3'
(R):5'- TCCCTAGGGAGTGAGAATCAGTG -3'

Sequencing Primer
(F):5'- AGCGGTACCGACCCTCATC -3'
(R):5'- ACTAGGTCTGAATGGGCACTTG -3'
Posted On2016-05-10