Incidental Mutation 'R5017:Sycp1'
ID385606
Institutional Source Beutler Lab
Gene Symbol Sycp1
Ensembl Gene ENSMUSG00000027855
Gene Namesynaptonemal complex protein 1
SynonymsSCP1
MMRRC Submission 042608-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.487) question?
Stock #R5017 (G1)
Quality Score162
Status Validated
Chromosome3
Chromosomal Location102818499-102936100 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 102895987 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029448] [ENSMUST00000029448] [ENSMUST00000196988] [ENSMUST00000196988]
Predicted Effect probably null
Transcript: ENSMUST00000029448
SMART Domains Protein: ENSMUSP00000029448
Gene: ENSMUSG00000027855

DomainStartEndE-ValueType
Pfam:SCP-1 28 809 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000029448
SMART Domains Protein: ENSMUSP00000029448
Gene: ENSMUSG00000027855

DomainStartEndE-ValueType
Pfam:SCP-1 28 809 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000196988
SMART Domains Protein: ENSMUSP00000143651
Gene: ENSMUSG00000027855

DomainStartEndE-ValueType
Pfam:SCP-1 28 809 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000196988
SMART Domains Protein: ENSMUSP00000143651
Gene: ENSMUSG00000027855

DomainStartEndE-ValueType
Pfam:SCP-1 28 809 N/A PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.1%
  • 3x: 97.0%
  • 10x: 94.3%
  • 20x: 87.9%
Validation Efficiency 96% (46/48)
MGI Phenotype PHENOTYPE: Homozygous null mice display male and female infertility, azoospermia, small ovary, small testis and seminiferous tubules, absent ovarian follicles, and failure of synapse formation during meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,296,676 F167I unknown Het
Adamdec1 T C 14: 68,573,245 D154G probably benign Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Arhgef3 G T 14: 27,265,530 R20L possibly damaging Het
Birc2 A T 9: 7,818,885 C568* probably null Het
Cep44 A G 8: 56,544,207 S99P possibly damaging Het
Clstn2 A G 9: 97,483,086 W456R probably damaging Het
Cog5 T A 12: 31,920,605 S783T probably benign Het
Endod1 G A 9: 14,356,891 R433* probably null Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gdpd4 C A 7: 98,004,275 Y498* probably null Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Hapln2 A G 3: 88,024,001 V69A probably damaging Het
Ifit3 A C 19: 34,587,192 N46T possibly damaging Het
Kcnh8 T C 17: 52,893,930 L464S probably damaging Het
Lrrc9 C A 12: 72,506,325 R1334S possibly damaging Het
Macf1 A G 4: 123,452,113 F2631L probably damaging Het
Mafa T C 15: 75,747,489 H145R probably benign Het
Muc6 T C 7: 141,640,528 T1411A probably benign Het
Nos3 A G 5: 24,366,719 probably benign Het
Nwd2 T A 5: 63,650,141 probably benign Het
Olfr160 A T 9: 37,711,525 Y251* probably null Het
Olfr44 A T 9: 39,484,755 M166K possibly damaging Het
Olfr981 A T 9: 40,022,376 probably benign Het
Pde11a A T 2: 76,136,367 D579E probably benign Het
Phkb A T 8: 86,049,809 H954L probably benign Het
Phldb3 C T 7: 24,620,096 T353M probably damaging Het
Pigu A T 2: 155,299,208 probably null Het
Pla2r1 A G 2: 60,522,760 probably null Het
Polr1c G T 17: 46,247,709 probably benign Het
Setbp1 C A 18: 78,856,594 G1286V possibly damaging Het
Siglecg T A 7: 43,411,386 probably benign Het
Slc25a46 A T 18: 31,605,783 H118Q probably damaging Het
Tmem132c A G 5: 127,563,350 T862A probably benign Het
Tmem256 T C 11: 69,838,992 probably benign Het
Tpr A T 1: 150,398,637 E98D probably benign Het
Trdn A G 10: 33,468,159 D623G probably benign Het
Trip11 T C 12: 101,846,620 N1485S probably benign Het
Trpm1 T C 7: 64,244,832 probably benign Het
Uhrf1bp1 T A 17: 27,894,739 L1295* probably null Het
Vmn1r227 T C 17: 20,736,078 noncoding transcript Het
Xpo6 G A 7: 126,104,747 A21V probably benign Het
Zfp276 A G 8: 123,264,977 probably benign Het
Other mutations in Sycp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Sycp1 APN 3 102840962 missense probably benign
IGL00833:Sycp1 APN 3 102876301 critical splice donor site probably null
IGL01066:Sycp1 APN 3 102920634 missense probably damaging 1.00
IGL01484:Sycp1 APN 3 102915867 missense probably benign 0.01
IGL02139:Sycp1 APN 3 102865114 missense probably benign 0.00
IGL02270:Sycp1 APN 3 102895943 missense probably benign 0.12
IGL02347:Sycp1 APN 3 102893547 missense probably benign 0.00
IGL02630:Sycp1 APN 3 102878764 splice site probably benign
IGL02668:Sycp1 APN 3 102820531 splice site probably benign
IGL02928:Sycp1 APN 3 102818818 utr 3 prime probably benign
PIT4458001:Sycp1 UTSW 3 102934833 missense probably benign 0.01
R0027:Sycp1 UTSW 3 102895910 missense probably benign
R0282:Sycp1 UTSW 3 102915795 splice site probably benign
R0462:Sycp1 UTSW 3 102819106 missense possibly damaging 0.75
R0609:Sycp1 UTSW 3 102898849 splice site probably null
R0837:Sycp1 UTSW 3 102915245 missense probably benign 0.17
R1301:Sycp1 UTSW 3 102920622 missense probably benign 0.02
R2408:Sycp1 UTSW 3 102925259 missense probably damaging 1.00
R2449:Sycp1 UTSW 3 102925206 missense probably benign 0.15
R2516:Sycp1 UTSW 3 102845066 missense probably benign 0.09
R2880:Sycp1 UTSW 3 102818898 missense probably damaging 0.99
R3410:Sycp1 UTSW 3 102841041 missense possibly damaging 0.94
R3427:Sycp1 UTSW 3 102876350 missense probably benign 0.00
R4538:Sycp1 UTSW 3 102840962 missense probably benign
R4679:Sycp1 UTSW 3 102922462 critical splice acceptor site probably null
R4707:Sycp1 UTSW 3 102853489 missense possibly damaging 0.92
R4785:Sycp1 UTSW 3 102853489 missense possibly damaging 0.92
R5036:Sycp1 UTSW 3 102820600 missense probably damaging 1.00
R5044:Sycp1 UTSW 3 102845054 missense probably benign 0.03
R5070:Sycp1 UTSW 3 102920565 missense probably damaging 0.97
R5079:Sycp1 UTSW 3 102878800 missense possibly damaging 0.67
R5289:Sycp1 UTSW 3 102934253 missense possibly damaging 0.85
R5393:Sycp1 UTSW 3 102841047 splice site probably null
R5477:Sycp1 UTSW 3 102818890 missense probably damaging 1.00
R5576:Sycp1 UTSW 3 102818902 missense probably damaging 0.98
R5814:Sycp1 UTSW 3 102895897 missense probably benign 0.03
R6291:Sycp1 UTSW 3 102908961 missense probably damaging 1.00
R6460:Sycp1 UTSW 3 102925253 missense probably damaging 1.00
R6527:Sycp1 UTSW 3 102898887 missense probably benign 0.09
R6870:Sycp1 UTSW 3 102935603 missense probably damaging 1.00
R6873:Sycp1 UTSW 3 102840980 missense probably benign
R7037:Sycp1 UTSW 3 102898934 missense possibly damaging 0.62
R7210:Sycp1 UTSW 3 102853492 missense probably damaging 1.00
R7405:Sycp1 UTSW 3 102925227 missense possibly damaging 0.72
R7604:Sycp1 UTSW 3 102913433 missense probably damaging 0.98
R7733:Sycp1 UTSW 3 102895962 missense probably benign 0.00
R7858:Sycp1 UTSW 3 102898957 missense probably benign 0.09
R7909:Sycp1 UTSW 3 102820626 nonsense probably null
R7941:Sycp1 UTSW 3 102898957 missense probably benign 0.09
R7990:Sycp1 UTSW 3 102820626 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTCCCTCTACTTTTGAAGTTAAGA -3'
(R):5'- ACGACTTTGTAAGAATGGTTGC -3'

Sequencing Primer
(F):5'- GGGCCATATCACTTGCTT -3'
(R):5'- GAGCAATTATGTGGAAAATATGTGC -3'
Posted On2016-05-10