Incidental Mutation 'R5017:Gdpd4'
ID385615
Institutional Source Beutler Lab
Gene Symbol Gdpd4
Ensembl Gene ENSMUSG00000035582
Gene Nameglycerophosphodiester phosphodiesterase domain containing 4
Synonyms
MMRRC Submission 042608-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R5017 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location97919955-98049663 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 98004275 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 498 (Y498*)
Ref Sequence ENSEMBL: ENSMUSP00000131960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041860] [ENSMUST00000170049]
Predicted Effect probably null
Transcript: ENSMUST00000041860
AA Change: Y498*
SMART Domains Protein: ENSMUSP00000036772
Gene: ENSMUSG00000035582
AA Change: Y498*

DomainStartEndE-ValueType
transmembrane domain 65 84 N/A INTRINSIC
transmembrane domain 104 135 N/A INTRINSIC
transmembrane domain 148 168 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
transmembrane domain 241 263 N/A INTRINSIC
Pfam:GDPD 281 440 1.4e-19 PFAM
transmembrane domain 543 565 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170049
AA Change: Y498*
SMART Domains Protein: ENSMUSP00000131960
Gene: ENSMUSG00000035582
AA Change: Y498*

DomainStartEndE-ValueType
transmembrane domain 65 84 N/A INTRINSIC
transmembrane domain 104 135 N/A INTRINSIC
transmembrane domain 148 168 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
transmembrane domain 241 263 N/A INTRINSIC
Pfam:GDPD 281 439 3.4e-21 PFAM
transmembrane domain 543 565 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.1%
  • 3x: 97.0%
  • 10x: 94.3%
  • 20x: 87.9%
Validation Efficiency 96% (46/48)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,296,676 F167I unknown Het
Adamdec1 T C 14: 68,573,245 D154G probably benign Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Arhgef3 G T 14: 27,265,530 R20L possibly damaging Het
Birc2 A T 9: 7,818,885 C568* probably null Het
Cep44 A G 8: 56,544,207 S99P possibly damaging Het
Clstn2 A G 9: 97,483,086 W456R probably damaging Het
Cog5 T A 12: 31,920,605 S783T probably benign Het
Endod1 G A 9: 14,356,891 R433* probably null Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Hapln2 A G 3: 88,024,001 V69A probably damaging Het
Ifit3 A C 19: 34,587,192 N46T possibly damaging Het
Kcnh8 T C 17: 52,893,930 L464S probably damaging Het
Lrrc9 C A 12: 72,506,325 R1334S possibly damaging Het
Macf1 A G 4: 123,452,113 F2631L probably damaging Het
Mafa T C 15: 75,747,489 H145R probably benign Het
Muc6 T C 7: 141,640,528 T1411A probably benign Het
Nos3 A G 5: 24,366,719 probably benign Het
Nwd2 T A 5: 63,650,141 probably benign Het
Olfr160 A T 9: 37,711,525 Y251* probably null Het
Olfr44 A T 9: 39,484,755 M166K possibly damaging Het
Olfr981 A T 9: 40,022,376 probably benign Het
Pde11a A T 2: 76,136,367 D579E probably benign Het
Phkb A T 8: 86,049,809 H954L probably benign Het
Phldb3 C T 7: 24,620,096 T353M probably damaging Het
Pigu A T 2: 155,299,208 probably null Het
Pla2r1 A G 2: 60,522,760 probably null Het
Polr1c G T 17: 46,247,709 probably benign Het
Setbp1 C A 18: 78,856,594 G1286V possibly damaging Het
Siglecg T A 7: 43,411,386 probably benign Het
Slc25a46 A T 18: 31,605,783 H118Q probably damaging Het
Sycp1 A T 3: 102,895,987 probably null Het
Tmem132c A G 5: 127,563,350 T862A probably benign Het
Tmem256 T C 11: 69,838,992 probably benign Het
Tpr A T 1: 150,398,637 E98D probably benign Het
Trdn A G 10: 33,468,159 D623G probably benign Het
Trip11 T C 12: 101,846,620 N1485S probably benign Het
Trpm1 T C 7: 64,244,832 probably benign Het
Uhrf1bp1 T A 17: 27,894,739 L1295* probably null Het
Vmn1r227 T C 17: 20,736,078 noncoding transcript Het
Xpo6 G A 7: 126,104,747 A21V probably benign Het
Zfp276 A G 8: 123,264,977 probably benign Het
Other mutations in Gdpd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Gdpd4 APN 7 98004271 missense probably damaging 1.00
IGL01292:Gdpd4 APN 7 98014954 splice site probably benign
IGL01317:Gdpd4 APN 7 97998258 missense possibly damaging 0.74
IGL02678:Gdpd4 APN 7 97974377 splice site probably benign
IGL02822:Gdpd4 APN 7 97971924 missense possibly damaging 0.82
IGL02987:Gdpd4 APN 7 97961551 splice site probably benign
R0022:Gdpd4 UTSW 7 97982875 missense probably damaging 1.00
R0331:Gdpd4 UTSW 7 97973008 missense probably benign 0.11
R0882:Gdpd4 UTSW 7 97966298 missense probably damaging 1.00
R1425:Gdpd4 UTSW 7 97974012 missense probably benign 0.03
R1469:Gdpd4 UTSW 7 97974466 splice site probably null
R1469:Gdpd4 UTSW 7 97974466 splice site probably null
R1870:Gdpd4 UTSW 7 97972955 missense probably benign 0.00
R4747:Gdpd4 UTSW 7 97961633 missense possibly damaging 0.80
R5208:Gdpd4 UTSW 7 98014911 missense probably benign 0.11
R5290:Gdpd4 UTSW 7 97966336 missense possibly damaging 0.94
R5398:Gdpd4 UTSW 7 97971978 missense probably benign 0.00
R5605:Gdpd4 UTSW 7 98006300 missense probably benign 0.41
R5715:Gdpd4 UTSW 7 97961597 missense probably benign 0.00
R5990:Gdpd4 UTSW 7 98040930 missense probably benign 0.00
R6269:Gdpd4 UTSW 7 97974462 missense probably damaging 1.00
R6314:Gdpd4 UTSW 7 97973953 missense probably damaging 0.98
R6817:Gdpd4 UTSW 7 97957830 missense probably benign 0.00
R6884:Gdpd4 UTSW 7 97972175 missense probably damaging 1.00
R7054:Gdpd4 UTSW 7 97973929 missense probably damaging 0.99
R7575:Gdpd4 UTSW 7 97998241 missense probably benign 0.00
R7582:Gdpd4 UTSW 7 97957805 critical splice acceptor site probably null
R7694:Gdpd4 UTSW 7 97971939 missense probably benign 0.24
Z1088:Gdpd4 UTSW 7 97966309 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATTCGGTCTCAGCGAATCGG -3'
(R):5'- AGGCACATTTCCATTACTCACAGATC -3'

Sequencing Primer
(F):5'- AGCGAATCGGAAGCTGTCTTTTG -3'
(R):5'- AGATCTCTGTATTCTGACGTAGC -3'
Posted On2016-05-10