Incidental Mutation 'R5017:Cep44'
ID385618
Institutional Source Beutler Lab
Gene Symbol Cep44
Ensembl Gene ENSMUSG00000038215
Gene Namecentrosomal protein 44
Synonyms4933440G23Rik, BC088983
MMRRC Submission 042608-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.390) question?
Stock #R5017 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location56531522-56551047 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56544207 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 99 (S99P)
Ref Sequence ENSEMBL: ENSMUSP00000042586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040330] [ENSMUST00000130930] [ENSMUST00000134162] [ENSMUST00000135337] [ENSMUST00000140107]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040330
AA Change: S99P

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000042586
Gene: ENSMUSG00000038215
AA Change: S99P

DomainStartEndE-ValueType
Pfam:CEP44 5 131 2.5e-52 PFAM
coiled coil region 232 263 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000123493
AA Change: S40P
SMART Domains Protein: ENSMUSP00000116884
Gene: ENSMUSG00000038215
AA Change: S40P

DomainStartEndE-ValueType
Pfam:CEP44 1 73 3.3e-31 PFAM
coiled coil region 173 204 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127877
Predicted Effect probably benign
Transcript: ENSMUST00000130930
SMART Domains Protein: ENSMUSP00000118959
Gene: ENSMUSG00000038215

DomainStartEndE-ValueType
Pfam:CEP44 5 63 3.2e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000134162
AA Change: S99P

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117526
Gene: ENSMUSG00000038215
AA Change: S99P

DomainStartEndE-ValueType
Pfam:CEP44 5 102 9.1e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135337
SMART Domains Protein: ENSMUSP00000122835
Gene: ENSMUSG00000038215

DomainStartEndE-ValueType
Pfam:CEP44 5 80 1e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000140107
AA Change: S99P

PolyPhen 2 Score 0.689 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000114502
Gene: ENSMUSG00000038215
AA Change: S99P

DomainStartEndE-ValueType
Pfam:CEP44 5 136 1.7e-53 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.1%
  • 3x: 97.0%
  • 10x: 94.3%
  • 20x: 87.9%
Validation Efficiency 96% (46/48)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,296,676 F167I unknown Het
Adamdec1 T C 14: 68,573,245 D154G probably benign Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Arhgef3 G T 14: 27,265,530 R20L possibly damaging Het
Birc2 A T 9: 7,818,885 C568* probably null Het
Clstn2 A G 9: 97,483,086 W456R probably damaging Het
Cog5 T A 12: 31,920,605 S783T probably benign Het
Endod1 G A 9: 14,356,891 R433* probably null Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gdpd4 C A 7: 98,004,275 Y498* probably null Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Hapln2 A G 3: 88,024,001 V69A probably damaging Het
Ifit3 A C 19: 34,587,192 N46T possibly damaging Het
Kcnh8 T C 17: 52,893,930 L464S probably damaging Het
Lrrc9 C A 12: 72,506,325 R1334S possibly damaging Het
Macf1 A G 4: 123,452,113 F2631L probably damaging Het
Mafa T C 15: 75,747,489 H145R probably benign Het
Muc6 T C 7: 141,640,528 T1411A probably benign Het
Nos3 A G 5: 24,366,719 probably benign Het
Nwd2 T A 5: 63,650,141 probably benign Het
Olfr160 A T 9: 37,711,525 Y251* probably null Het
Olfr44 A T 9: 39,484,755 M166K possibly damaging Het
Olfr981 A T 9: 40,022,376 probably benign Het
Pde11a A T 2: 76,136,367 D579E probably benign Het
Phkb A T 8: 86,049,809 H954L probably benign Het
Phldb3 C T 7: 24,620,096 T353M probably damaging Het
Pigu A T 2: 155,299,208 probably null Het
Pla2r1 A G 2: 60,522,760 probably null Het
Polr1c G T 17: 46,247,709 probably benign Het
Setbp1 C A 18: 78,856,594 G1286V possibly damaging Het
Siglecg T A 7: 43,411,386 probably benign Het
Slc25a46 A T 18: 31,605,783 H118Q probably damaging Het
Sycp1 A T 3: 102,895,987 probably null Het
Tmem132c A G 5: 127,563,350 T862A probably benign Het
Tmem256 T C 11: 69,838,992 probably benign Het
Tpr A T 1: 150,398,637 E98D probably benign Het
Trdn A G 10: 33,468,159 D623G probably benign Het
Trip11 T C 12: 101,846,620 N1485S probably benign Het
Trpm1 T C 7: 64,244,832 probably benign Het
Uhrf1bp1 T A 17: 27,894,739 L1295* probably null Het
Vmn1r227 T C 17: 20,736,078 noncoding transcript Het
Xpo6 G A 7: 126,104,747 A21V probably benign Het
Zfp276 A G 8: 123,264,977 probably benign Het
Other mutations in Cep44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00545:Cep44 APN 8 56547400 missense probably damaging 1.00
IGL02932:Cep44 APN 8 56547424 missense probably damaging 1.00
R0347:Cep44 UTSW 8 56545475 missense probably damaging 1.00
R0609:Cep44 UTSW 8 56544152 missense possibly damaging 0.79
R0669:Cep44 UTSW 8 56540973 missense possibly damaging 0.74
R1449:Cep44 UTSW 8 56540950 missense probably benign 0.01
R1493:Cep44 UTSW 8 56532835 missense probably damaging 1.00
R4114:Cep44 UTSW 8 56545422 missense probably benign 0.25
R4422:Cep44 UTSW 8 56538617 missense probably benign 0.00
R4423:Cep44 UTSW 8 56538617 missense probably benign 0.00
R4425:Cep44 UTSW 8 56538617 missense probably benign 0.00
R4621:Cep44 UTSW 8 56542916 missense probably damaging 0.99
R5190:Cep44 UTSW 8 56532796 missense probably benign 0.05
R5898:Cep44 UTSW 8 56541021 missense probably damaging 1.00
R5938:Cep44 UTSW 8 56547422 missense possibly damaging 0.93
R6080:Cep44 UTSW 8 56539841 missense possibly damaging 0.50
R6150:Cep44 UTSW 8 56539805 missense probably benign 0.39
R7016:Cep44 UTSW 8 56544199 missense possibly damaging 0.89
R7141:Cep44 UTSW 8 56539851 missense probably damaging 1.00
R7466:Cep44 UTSW 8 56540983 frame shift probably null
R7753:Cep44 UTSW 8 56532807 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TTCTGCGTCGATTGACCATG -3'
(R):5'- CCTGAGCATAATTCAACGCC -3'

Sequencing Primer
(F):5'- GACCATGCGCTTTTAAATAATTTGC -3'
(R):5'- AACGCCAACTCTATACTTTTAGTACC -3'
Posted On2016-05-10