Incidental Mutation 'R5017:Trdn'
ID385627
Institutional Source Beutler Lab
Gene Symbol Trdn
Ensembl Gene ENSMUSG00000019787
Gene Nametriadin
Synonymstriadin-2, triadin 2, triadin 1, triadin 3, EG432451, 2310045H21Rik, triadin-1, triadin-3
MMRRC Submission 042608-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5017 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location33080554-33476709 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33468159 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 623 (D623G)
Ref Sequence ENSEMBL: ENSMUSP00000093436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095762]
Predicted Effect probably benign
Transcript: ENSMUST00000095762
AA Change: D623G

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000093436
Gene: ENSMUSG00000019787
AA Change: D623G

DomainStartEndE-ValueType
SCOP:d1lnqa2 49 116 1e-4 SMART
low complexity region 147 158 N/A INTRINSIC
low complexity region 166 182 N/A INTRINSIC
low complexity region 198 223 N/A INTRINSIC
low complexity region 229 250 N/A INTRINSIC
coiled coil region 306 333 N/A INTRINSIC
low complexity region 342 352 N/A INTRINSIC
low complexity region 380 396 N/A INTRINSIC
coiled coil region 417 437 N/A INTRINSIC
low complexity region 448 484 N/A INTRINSIC
low complexity region 539 551 N/A INTRINSIC
low complexity region 559 572 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218168
Meta Mutation Damage Score 0.0910 question?
Coding Region Coverage
  • 1x: 98.1%
  • 3x: 97.0%
  • 10x: 94.3%
  • 20x: 87.9%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that contains a single transmembrane domain. As similar protein in rabbits plays a role in skeletal muscle excitation-contraction coupling as part of the calcium release complex in association with the ryanodine receptor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and single nucleotide polymorphisms in this gene may be markers for IgA nephritis. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit a loss of transverse orientation of triads within skeletal muscle cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,296,676 F167I unknown Het
Adamdec1 T C 14: 68,573,245 D154G probably benign Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Arhgef3 G T 14: 27,265,530 R20L possibly damaging Het
Birc2 A T 9: 7,818,885 C568* probably null Het
Cep44 A G 8: 56,544,207 S99P possibly damaging Het
Clstn2 A G 9: 97,483,086 W456R probably damaging Het
Cog5 T A 12: 31,920,605 S783T probably benign Het
Endod1 G A 9: 14,356,891 R433* probably null Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gdpd4 C A 7: 98,004,275 Y498* probably null Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Hapln2 A G 3: 88,024,001 V69A probably damaging Het
Ifit3 A C 19: 34,587,192 N46T possibly damaging Het
Kcnh8 T C 17: 52,893,930 L464S probably damaging Het
Lrrc9 C A 12: 72,506,325 R1334S possibly damaging Het
Macf1 A G 4: 123,452,113 F2631L probably damaging Het
Mafa T C 15: 75,747,489 H145R probably benign Het
Muc6 T C 7: 141,640,528 T1411A probably benign Het
Nos3 A G 5: 24,366,719 probably benign Het
Nwd2 T A 5: 63,650,141 probably benign Het
Olfr160 A T 9: 37,711,525 Y251* probably null Het
Olfr44 A T 9: 39,484,755 M166K possibly damaging Het
Olfr981 A T 9: 40,022,376 probably benign Het
Pde11a A T 2: 76,136,367 D579E probably benign Het
Phkb A T 8: 86,049,809 H954L probably benign Het
Phldb3 C T 7: 24,620,096 T353M probably damaging Het
Pigu A T 2: 155,299,208 probably null Het
Pla2r1 A G 2: 60,522,760 probably null Het
Polr1c G T 17: 46,247,709 probably benign Het
Setbp1 C A 18: 78,856,594 G1286V possibly damaging Het
Siglecg T A 7: 43,411,386 probably benign Het
Slc25a46 A T 18: 31,605,783 H118Q probably damaging Het
Sycp1 A T 3: 102,895,987 probably null Het
Tmem132c A G 5: 127,563,350 T862A probably benign Het
Tmem256 T C 11: 69,838,992 probably benign Het
Tpr A T 1: 150,398,637 E98D probably benign Het
Trip11 T C 12: 101,846,620 N1485S probably benign Het
Trpm1 T C 7: 64,244,832 probably benign Het
Uhrf1bp1 T A 17: 27,894,739 L1295* probably null Het
Vmn1r227 T C 17: 20,736,078 noncoding transcript Het
Xpo6 G A 7: 126,104,747 A21V probably benign Het
Zfp276 A G 8: 123,264,977 probably benign Het
Other mutations in Trdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Trdn APN 10 33471606 critical splice donor site probably null
IGL01310:Trdn APN 10 33305098 splice site probably benign
IGL01313:Trdn APN 10 33200220 missense probably damaging 1.00
IGL02177:Trdn APN 10 33139173 missense probably damaging 1.00
IGL02631:Trdn APN 10 33363976 critical splice acceptor site probably null
IGL02732:Trdn APN 10 33468199 splice site probably null
IGL03131:Trdn APN 10 33398414 nonsense probably null
Button UTSW 10 33474453 missense probably damaging 0.97
R0463:Trdn UTSW 10 33466421 critical splice acceptor site probably null
R0610:Trdn UTSW 10 33474453 missense probably damaging 0.97
R0786:Trdn UTSW 10 33305081 missense probably benign 0.22
R0827:Trdn UTSW 10 33399158 splice site probably benign
R1511:Trdn UTSW 10 33466452 missense probably benign 0.18
R1623:Trdn UTSW 10 33258102 missense possibly damaging 0.82
R1760:Trdn UTSW 10 33233887 missense possibly damaging 0.92
R1766:Trdn UTSW 10 33364008 missense probably damaging 1.00
R1884:Trdn UTSW 10 33257095 missense probably benign 0.38
R2297:Trdn UTSW 10 33335012 missense probably damaging 1.00
R2396:Trdn UTSW 10 33195982 missense probably damaging 1.00
R3436:Trdn UTSW 10 33468195 critical splice donor site probably null
R3686:Trdn UTSW 10 33468189 missense probably benign 0.20
R3696:Trdn UTSW 10 33305032 splice site probably null
R3701:Trdn UTSW 10 33334984 missense probably damaging 0.99
R3712:Trdn UTSW 10 33157166 missense probably benign 0.03
R4062:Trdn UTSW 10 33257087 missense probably benign 0.05
R4249:Trdn UTSW 10 33450998 missense probably benign 0.09
R4289:Trdn UTSW 10 33464582 missense probably benign 0.00
R4646:Trdn UTSW 10 33195981 nonsense probably null
R4647:Trdn UTSW 10 33195981 nonsense probably null
R4648:Trdn UTSW 10 33195981 nonsense probably null
R4766:Trdn UTSW 10 33474506 missense probably benign 0.04
R4776:Trdn UTSW 10 33399082 splice site probably null
R4880:Trdn UTSW 10 33471579 missense probably benign 0.26
R4898:Trdn UTSW 10 33474417 missense probably damaging 0.96
R5300:Trdn UTSW 10 33195982 missense probably damaging 1.00
R5320:Trdn UTSW 10 33333251 critical splice donor site probably null
R6089:Trdn UTSW 10 33464575 missense probably benign 0.01
R6216:Trdn UTSW 10 33305069 missense probably damaging 1.00
R6431:Trdn UTSW 10 33139114 missense probably damaging 1.00
R6475:Trdn UTSW 10 33464555 splice site probably null
R6501:Trdn UTSW 10 33466454 missense probably benign 0.02
R6662:Trdn UTSW 10 33474487 missense probably damaging 0.98
R6709:Trdn UTSW 10 33464591 missense probably benign 0.00
R6783:Trdn UTSW 10 33438815 missense probably damaging 0.96
R6906:Trdn UTSW 10 33233948 missense probably benign
R6916:Trdn UTSW 10 33157018 missense probably damaging 1.00
R7291:Trdn UTSW 10 33437736 missense probably null 0.83
R7499:Trdn UTSW 10 33196101 missense probably benign
R7601:Trdn UTSW 10 33196156 missense probably benign 0.00
R7743:Trdn UTSW 10 33257062 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTTTTCTCTGGTGAGTTATTAACC -3'
(R):5'- CCTAGCTTTTCTTCAATATTCAAGGAG -3'

Sequencing Primer
(F):5'- GGCTTCCTTTTCTCTAAGTA -3'
(R):5'- AAGTGCTCAAAAATGCCT -3'
Posted On2016-05-10