Incidental Mutation 'R5017:Tmem256'
ID385628
Institutional Source Beutler Lab
Gene Symbol Tmem256
Ensembl Gene ENSMUSG00000070394
Gene Nametransmembrane protein 256
Synonyms1810027O10Rik, 3110009M16Rik
MMRRC Submission 042608-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5017 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69838514-69839618 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 69838992 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000056484] [ENSMUST00000094065] [ENSMUST00000108634]
Predicted Effect probably benign
Transcript: ENSMUST00000056484
SMART Domains Protein: ENSMUSP00000053097
Gene: ENSMUSG00000051790

DomainStartEndE-ValueType
Pfam:COesterase 31 601 1.6e-199 PFAM
Pfam:Abhydrolase_3 180 372 4.8e-9 PFAM
low complexity region 630 652 N/A INTRINSIC
transmembrane domain 678 700 N/A INTRINSIC
low complexity region 702 712 N/A INTRINSIC
low complexity region 713 731 N/A INTRINSIC
low complexity region 782 823 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094065
SMART Domains Protein: ENSMUSP00000091608
Gene: ENSMUSG00000070394

DomainStartEndE-ValueType
Pfam:DUF423 21 102 1.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108634
SMART Domains Protein: ENSMUSP00000104274
Gene: ENSMUSG00000051790

DomainStartEndE-ValueType
Pfam:COesterase 30 601 2e-186 PFAM
Pfam:Abhydrolase_3 180 327 3.3e-9 PFAM
low complexity region 630 652 N/A INTRINSIC
transmembrane domain 678 700 N/A INTRINSIC
low complexity region 702 712 N/A INTRINSIC
low complexity region 713 731 N/A INTRINSIC
low complexity region 782 823 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128281
Predicted Effect probably benign
Transcript: ENSMUST00000133967
SMART Domains Protein: ENSMUSP00000114883
Gene: ENSMUSG00000070394

DomainStartEndE-ValueType
Pfam:DUF423 13 94 5.7e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139085
Predicted Effect probably benign
Transcript: ENSMUST00000139893
SMART Domains Protein: ENSMUSP00000120428
Gene: ENSMUSG00000051790

DomainStartEndE-ValueType
Pfam:COesterase 1 262 9.3e-120 PFAM
Pfam:Abhydrolase_3 104 250 2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156556
Coding Region Coverage
  • 1x: 98.1%
  • 3x: 97.0%
  • 10x: 94.3%
  • 20x: 87.9%
Validation Efficiency 96% (46/48)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,296,676 F167I unknown Het
Adamdec1 T C 14: 68,573,245 D154G probably benign Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Arhgef3 G T 14: 27,265,530 R20L possibly damaging Het
Birc2 A T 9: 7,818,885 C568* probably null Het
Cep44 A G 8: 56,544,207 S99P possibly damaging Het
Clstn2 A G 9: 97,483,086 W456R probably damaging Het
Cog5 T A 12: 31,920,605 S783T probably benign Het
Endod1 G A 9: 14,356,891 R433* probably null Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gdpd4 C A 7: 98,004,275 Y498* probably null Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Hapln2 A G 3: 88,024,001 V69A probably damaging Het
Ifit3 A C 19: 34,587,192 N46T possibly damaging Het
Kcnh8 T C 17: 52,893,930 L464S probably damaging Het
Lrrc9 C A 12: 72,506,325 R1334S possibly damaging Het
Macf1 A G 4: 123,452,113 F2631L probably damaging Het
Mafa T C 15: 75,747,489 H145R probably benign Het
Muc6 T C 7: 141,640,528 T1411A probably benign Het
Nos3 A G 5: 24,366,719 probably benign Het
Nwd2 T A 5: 63,650,141 probably benign Het
Olfr160 A T 9: 37,711,525 Y251* probably null Het
Olfr44 A T 9: 39,484,755 M166K possibly damaging Het
Olfr981 A T 9: 40,022,376 probably benign Het
Pde11a A T 2: 76,136,367 D579E probably benign Het
Phkb A T 8: 86,049,809 H954L probably benign Het
Phldb3 C T 7: 24,620,096 T353M probably damaging Het
Pigu A T 2: 155,299,208 probably null Het
Pla2r1 A G 2: 60,522,760 probably null Het
Polr1c G T 17: 46,247,709 probably benign Het
Setbp1 C A 18: 78,856,594 G1286V possibly damaging Het
Siglecg T A 7: 43,411,386 probably benign Het
Slc25a46 A T 18: 31,605,783 H118Q probably damaging Het
Sycp1 A T 3: 102,895,987 probably null Het
Tmem132c A G 5: 127,563,350 T862A probably benign Het
Tpr A T 1: 150,398,637 E98D probably benign Het
Trdn A G 10: 33,468,159 D623G probably benign Het
Trip11 T C 12: 101,846,620 N1485S probably benign Het
Trpm1 T C 7: 64,244,832 probably benign Het
Uhrf1bp1 T A 17: 27,894,739 L1295* probably null Het
Vmn1r227 T C 17: 20,736,078 noncoding transcript Het
Xpo6 G A 7: 126,104,747 A21V probably benign Het
Zfp276 A G 8: 123,264,977 probably benign Het
Other mutations in Tmem256
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00712:Tmem256 APN 11 69839237 missense probably damaging 1.00
R0305:Tmem256 UTSW 11 69838911 unclassified probably benign
R2201:Tmem256 UTSW 11 69839445 missense probably benign 0.15
R7056:Tmem256 UTSW 11 69838590 unclassified probably benign
Z1177:Tmem256 UTSW 11 69838571 missense unknown
Predicted Primers PCR Primer
(F):5'- ACATCTGTTTCCACCAGTCAG -3'
(R):5'- GTTGGCCTTGTCAAAGAGCTG -3'

Sequencing Primer
(F):5'- TCAGAAGCTTCCAGGGATGC -3'
(R):5'- CCTTGTCAAAGAGCTGTAAGAAAAAG -3'
Posted On2016-05-10