Incidental Mutation 'R5017:Cog5'
ID 385629
Institutional Source Beutler Lab
Gene Symbol Cog5
Ensembl Gene ENSMUSG00000035933
Gene Name component of oligomeric golgi complex 5
Synonyms 5430405C01Rik, GOLTC1, GTC90
MMRRC Submission 042608-MU
Accession Numbers

Ensembl: ENSMUST00000036862; MGI: 2145130
Is this an essential gene? Probably essential (E-score: 0.835) question?
Stock # R5017 (G1)
Quality Score 109
Status Validated
Chromosome 12
Chromosomal Location 31654869-31937630 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 31920605 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 783 (S783T)
Ref Sequence ENSEMBL: ENSMUSP00000044797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036862] [ENSMUST00000218428]
AlphaFold Q8C0L8
Predicted Effect probably benign
Transcript: ENSMUST00000036862
AA Change: S783T

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000044797
Gene: ENSMUSG00000035933
AA Change: S783T

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
Pfam:COG5 35 158 3.8e-37 PFAM
Pfam:Vps51 37 120 1.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218428
AA Change: S53T

PolyPhen 2 Score 0.118 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219672
Meta Mutation Damage Score 0.0697 question?
Coding Region Coverage
  • 1x: 98.1%
  • 3x: 97.0%
  • 10x: 94.3%
  • 20x: 87.9%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of eight proteins (Cog1-8) which form a Golgi-localized complex (COG) required for normal Golgi morphology and function. The encoded protein is organized with conserved oligomeric Golgi complex components 6, 7 and 8 into a sub-complex referred to as lobe B. Alternative splicing results in multiple transcript variants. Mutations in this gene result in congenital disorder of glycosylation type 2I.[provided by RefSeq, Jan 2011]
Allele List at MGI

All alleles(99) : Gene trapped(99)
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,296,676 F167I unknown Het
Adamdec1 T C 14: 68,573,245 D154G probably benign Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Arhgef3 G T 14: 27,265,530 R20L possibly damaging Het
Birc2 A T 9: 7,818,885 C568* probably null Het
Cep44 A G 8: 56,544,207 S99P possibly damaging Het
Clstn2 A G 9: 97,483,086 W456R probably damaging Het
Endod1 G A 9: 14,356,891 R433* probably null Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gdpd4 C A 7: 98,004,275 Y498* probably null Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Hapln2 A G 3: 88,024,001 V69A probably damaging Het
Ifit3 A C 19: 34,587,192 N46T possibly damaging Het
Kcnh8 T C 17: 52,893,930 L464S probably damaging Het
Lrrc9 C A 12: 72,506,325 R1334S possibly damaging Het
Macf1 A G 4: 123,452,113 F2631L probably damaging Het
Mafa T C 15: 75,747,489 H145R probably benign Het
Muc6 T C 7: 141,640,528 T1411A probably benign Het
Nos3 A G 5: 24,366,719 probably benign Het
Nwd2 T A 5: 63,650,141 probably benign Het
Olfr160 A T 9: 37,711,525 Y251* probably null Het
Olfr44 A T 9: 39,484,755 M166K possibly damaging Het
Olfr981 A T 9: 40,022,376 probably benign Het
Pde11a A T 2: 76,136,367 D579E probably benign Het
Phkb A T 8: 86,049,809 H954L probably benign Het
Phldb3 C T 7: 24,620,096 T353M probably damaging Het
Pigu A T 2: 155,299,208 probably null Het
Pla2r1 A G 2: 60,522,760 probably null Het
Polr1c G T 17: 46,247,709 probably benign Het
Setbp1 C A 18: 78,856,594 G1286V possibly damaging Het
Siglecg T A 7: 43,411,386 probably benign Het
Slc25a46 A T 18: 31,605,783 H118Q probably damaging Het
Sycp1 A T 3: 102,895,987 probably null Het
Tmem132c A G 5: 127,563,350 T862A probably benign Het
Tmem256 T C 11: 69,838,992 probably benign Het
Tpr A T 1: 150,398,637 E98D probably benign Het
Trdn A G 10: 33,468,159 D623G probably benign Het
Trip11 T C 12: 101,846,620 N1485S probably benign Het
Trpm1 T C 7: 64,244,832 probably benign Het
Uhrf1bp1 T A 17: 27,894,739 L1295* probably null Het
Vmn1r227 T C 17: 20,736,078 noncoding transcript Het
Xpo6 G A 7: 126,104,747 A21V probably benign Het
Zfp276 A G 8: 123,264,977 probably benign Het
Other mutations in Cog5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cog5 APN 12 31685704 missense probably damaging 1.00
IGL00495:Cog5 APN 12 31837309 missense probably benign 0.06
IGL00763:Cog5 APN 12 31665532 splice site probably benign
IGL00789:Cog5 APN 12 31760952 missense possibly damaging 0.95
IGL01288:Cog5 APN 12 31886206 missense probably benign 0.13
IGL01315:Cog5 APN 12 31760986 splice site probably benign
IGL01396:Cog5 APN 12 31894096 missense probably benign 0.01
IGL02468:Cog5 APN 12 31837358 critical splice donor site probably null
IGL03030:Cog5 APN 12 31790922 missense probably damaging 0.99
IGL03346:Cog5 APN 12 31894038 missense possibly damaging 0.88
R0201:Cog5 UTSW 12 31839841 missense probably damaging 0.99
R0356:Cog5 UTSW 12 31837181 splice site probably benign
R0492:Cog5 UTSW 12 31869461 missense probably damaging 1.00
R0646:Cog5 UTSW 12 31837359 splice site probably benign
R0971:Cog5 UTSW 12 31919678 missense probably benign 0.11
R1158:Cog5 UTSW 12 31870057 splice site probably benign
R1997:Cog5 UTSW 12 31660849 missense possibly damaging 0.66
R2167:Cog5 UTSW 12 31837289 missense probably damaging 0.99
R4414:Cog5 UTSW 12 31660854 nonsense probably null
R4755:Cog5 UTSW 12 31869406 splice site probably null
R4836:Cog5 UTSW 12 31919733 missense probably benign 0.07
R5256:Cog5 UTSW 12 31886205 missense probably benign
R5986:Cog5 UTSW 12 31660717 missense probably benign 0.03
R6131:Cog5 UTSW 12 31886221 missense possibly damaging 0.47
R6885:Cog5 UTSW 12 31894199 missense probably damaging 1.00
R7056:Cog5 UTSW 12 31665469 missense possibly damaging 0.65
R7177:Cog5 UTSW 12 31760889 missense probably damaging 1.00
R7182:Cog5 UTSW 12 31685708 missense probably damaging 1.00
R7418:Cog5 UTSW 12 31833241 missense probably damaging 1.00
R7445:Cog5 UTSW 12 31919672 missense possibly damaging 0.64
R7585:Cog5 UTSW 12 31760889 missense probably damaging 1.00
R8332:Cog5 UTSW 12 31833223 nonsense probably null
R8722:Cog5 UTSW 12 31919704 missense possibly damaging 0.82
R8781:Cog5 UTSW 12 31833250 missense probably damaging 1.00
R8911:Cog5 UTSW 12 31833239 missense probably damaging 1.00
R8979:Cog5 UTSW 12 31790895 missense probably benign 0.00
R9153:Cog5 UTSW 12 31660811 missense possibly damaging 0.87
X0062:Cog5 UTSW 12 31685692 missense probably benign 0.01
Z1177:Cog5 UTSW 12 31801985 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTAATCAGGTGCATGAAGCCC -3'
(R):5'- AGATATAGTCCCTGTGCCCAGC -3'

Sequencing Primer
(F):5'- TGCATGAAGCCCTGTGC -3'
(R):5'- CCCTACACTGCAGAGGGATC -3'
Posted On 2016-05-10