Incidental Mutation 'R5017:Arhgef3'
ID385632
Institutional Source Beutler Lab
Gene Symbol Arhgef3
Ensembl Gene ENSMUSG00000021895
Gene NameRho guanine nucleotide exchange factor (GEF) 3
Synonyms9830169H03Rik, 1200004I24Rik, C76747
MMRRC Submission 042608-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R5017 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location27114899-27403911 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 27265530 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 20 (R20L)
Ref Sequence ENSEMBL: ENSMUSP00000046486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049206] [ENSMUST00000225949]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049206
AA Change: R20L

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000046486
Gene: ENSMUSG00000021895
AA Change: R20L

DomainStartEndE-ValueType
RhoGEF 132 309 4.11e-51 SMART
PH 318 457 3.26e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000225949
AA Change: R40L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 98.1%
  • 3x: 97.0%
  • 10x: 94.3%
  • 20x: 87.9%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho-like GTPases are involved in a variety of cellular processes, and they are activated by binding GTP and inactivated by conversion of GTP to GDP by their intrinsic GTPase activity. Guanine nucleotide exchange factors (GEFs) accelerate the GTPase activity of Rho GTPases by catalyzing their release of bound GDP. This gene encodes a guanine nucleotide exchange factor, which specifically activates two members of the Rho GTPase family: RHOA and RHOB, both of which have a role in bone cell biology. It has been identified that genetic variation in this gene plays a role in the determination of bone mineral density (BMD), indicating the implication of this gene in postmenopausal osteoporosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased mean platelet volume and a mild delay in platelet recovery in response to thrombocytopenia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,296,676 F167I unknown Het
Adamdec1 T C 14: 68,573,245 D154G probably benign Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Birc2 A T 9: 7,818,885 C568* probably null Het
Cep44 A G 8: 56,544,207 S99P possibly damaging Het
Clstn2 A G 9: 97,483,086 W456R probably damaging Het
Cog5 T A 12: 31,920,605 S783T probably benign Het
Endod1 G A 9: 14,356,891 R433* probably null Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gdpd4 C A 7: 98,004,275 Y498* probably null Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Hapln2 A G 3: 88,024,001 V69A probably damaging Het
Ifit3 A C 19: 34,587,192 N46T possibly damaging Het
Kcnh8 T C 17: 52,893,930 L464S probably damaging Het
Lrrc9 C A 12: 72,506,325 R1334S possibly damaging Het
Macf1 A G 4: 123,452,113 F2631L probably damaging Het
Mafa T C 15: 75,747,489 H145R probably benign Het
Muc6 T C 7: 141,640,528 T1411A probably benign Het
Nos3 A G 5: 24,366,719 probably benign Het
Nwd2 T A 5: 63,650,141 probably benign Het
Olfr160 A T 9: 37,711,525 Y251* probably null Het
Olfr44 A T 9: 39,484,755 M166K possibly damaging Het
Olfr981 A T 9: 40,022,376 probably benign Het
Pde11a A T 2: 76,136,367 D579E probably benign Het
Phkb A T 8: 86,049,809 H954L probably benign Het
Phldb3 C T 7: 24,620,096 T353M probably damaging Het
Pigu A T 2: 155,299,208 probably null Het
Pla2r1 A G 2: 60,522,760 probably null Het
Polr1c G T 17: 46,247,709 probably benign Het
Setbp1 C A 18: 78,856,594 G1286V possibly damaging Het
Siglecg T A 7: 43,411,386 probably benign Het
Slc25a46 A T 18: 31,605,783 H118Q probably damaging Het
Sycp1 A T 3: 102,895,987 probably null Het
Tmem132c A G 5: 127,563,350 T862A probably benign Het
Tmem256 T C 11: 69,838,992 probably benign Het
Tpr A T 1: 150,398,637 E98D probably benign Het
Trdn A G 10: 33,468,159 D623G probably benign Het
Trip11 T C 12: 101,846,620 N1485S probably benign Het
Trpm1 T C 7: 64,244,832 probably benign Het
Uhrf1bp1 T A 17: 27,894,739 L1295* probably null Het
Vmn1r227 T C 17: 20,736,078 noncoding transcript Het
Xpo6 G A 7: 126,104,747 A21V probably benign Het
Zfp276 A G 8: 123,264,977 probably benign Het
Other mutations in Arhgef3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Arhgef3 APN 14 27401919 nonsense probably null
IGL02178:Arhgef3 APN 14 27265529 nonsense probably null
IGL02302:Arhgef3 APN 14 27362842 missense probably benign 0.08
IGL02505:Arhgef3 APN 14 27394000 missense possibly damaging 0.92
IGL03203:Arhgef3 APN 14 27394116 missense probably damaging 1.00
IGL03339:Arhgef3 APN 14 27401857 missense probably damaging 0.99
R0762:Arhgef3 UTSW 14 27397627 missense probably damaging 1.00
R1192:Arhgef3 UTSW 14 27379706 missense probably damaging 1.00
R1572:Arhgef3 UTSW 14 27401735 missense probably damaging 1.00
R1794:Arhgef3 UTSW 14 27397605 missense probably benign 0.44
R2426:Arhgef3 UTSW 14 27384181 nonsense probably null
R2509:Arhgef3 UTSW 14 27379676 missense probably damaging 1.00
R4932:Arhgef3 UTSW 14 27384213 missense probably damaging 0.99
R5216:Arhgef3 UTSW 14 27401842 missense probably benign 0.00
R6562:Arhgef3 UTSW 14 27152996 start gained probably benign
R6951:Arhgef3 UTSW 14 27144018 start gained probably benign
R7140:Arhgef3 UTSW 14 27401707 missense probably damaging 1.00
R7361:Arhgef3 UTSW 14 27265578 missense possibly damaging 0.56
R8042:Arhgef3 UTSW 14 27362809 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CACAGAACTTAATAGTCGTGTGTG -3'
(R):5'- AAGTCACATCTCCACAGCTGG -3'

Sequencing Primer
(F):5'- GTGTGTGTCGTGTCCCCATC -3'
(R):5'- GAGGTCCACTTGAAGCATGCATC -3'
Posted On2016-05-10