Incidental Mutation 'R5017:Adamdec1'
ID385633
Institutional Source Beutler Lab
Gene Symbol Adamdec1
Ensembl Gene ENSMUSG00000022057
Gene NameADAM-like, decysin 1
Synonyms2210414L24Rik, Dcsn
MMRRC Submission 042608-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5017 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location68563380-68582095 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 68573245 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 154 (D154G)
Ref Sequence ENSEMBL: ENSMUSP00000022641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022641]
Predicted Effect probably benign
Transcript: ENSMUST00000022641
AA Change: D154G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000022641
Gene: ENSMUSG00000022057
AA Change: D154G

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Pep_M12B_propep 37 175 3.9e-29 PFAM
Pfam:Reprolysin_5 215 389 9.8e-17 PFAM
Pfam:Reprolysin_4 216 407 7.3e-12 PFAM
Pfam:Reprolysin 217 411 1.5e-57 PFAM
Pfam:Reprolysin_3 242 360 1e-11 PFAM
DISIN 427 465 1.12e-3 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.1%
  • 3x: 97.0%
  • 10x: 94.3%
  • 20x: 87.9%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This encoded protein is thought to be a secreted protein belonging to the disintegrin metalloproteinase family. Its expression is upregulated during dendritic cells maturation. This protein may play an important role in dendritic cell function and their interactions with germinal center T cells. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,296,676 F167I unknown Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Arhgef3 G T 14: 27,265,530 R20L possibly damaging Het
Birc2 A T 9: 7,818,885 C568* probably null Het
Cep44 A G 8: 56,544,207 S99P possibly damaging Het
Clstn2 A G 9: 97,483,086 W456R probably damaging Het
Cog5 T A 12: 31,920,605 S783T probably benign Het
Endod1 G A 9: 14,356,891 R433* probably null Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gdpd4 C A 7: 98,004,275 Y498* probably null Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Hapln2 A G 3: 88,024,001 V69A probably damaging Het
Ifit3 A C 19: 34,587,192 N46T possibly damaging Het
Kcnh8 T C 17: 52,893,930 L464S probably damaging Het
Lrrc9 C A 12: 72,506,325 R1334S possibly damaging Het
Macf1 A G 4: 123,452,113 F2631L probably damaging Het
Mafa T C 15: 75,747,489 H145R probably benign Het
Muc6 T C 7: 141,640,528 T1411A probably benign Het
Nos3 A G 5: 24,366,719 probably benign Het
Nwd2 T A 5: 63,650,141 probably benign Het
Olfr160 A T 9: 37,711,525 Y251* probably null Het
Olfr44 A T 9: 39,484,755 M166K possibly damaging Het
Olfr981 A T 9: 40,022,376 probably benign Het
Pde11a A T 2: 76,136,367 D579E probably benign Het
Phkb A T 8: 86,049,809 H954L probably benign Het
Phldb3 C T 7: 24,620,096 T353M probably damaging Het
Pigu A T 2: 155,299,208 probably null Het
Pla2r1 A G 2: 60,522,760 probably null Het
Polr1c G T 17: 46,247,709 probably benign Het
Setbp1 C A 18: 78,856,594 G1286V possibly damaging Het
Siglecg T A 7: 43,411,386 probably benign Het
Slc25a46 A T 18: 31,605,783 H118Q probably damaging Het
Sycp1 A T 3: 102,895,987 probably null Het
Tmem132c A G 5: 127,563,350 T862A probably benign Het
Tmem256 T C 11: 69,838,992 probably benign Het
Tpr A T 1: 150,398,637 E98D probably benign Het
Trdn A G 10: 33,468,159 D623G probably benign Het
Trip11 T C 12: 101,846,620 N1485S probably benign Het
Trpm1 T C 7: 64,244,832 probably benign Het
Uhrf1bp1 T A 17: 27,894,739 L1295* probably null Het
Vmn1r227 T C 17: 20,736,078 noncoding transcript Het
Xpo6 G A 7: 126,104,747 A21V probably benign Het
Zfp276 A G 8: 123,264,977 probably benign Het
Other mutations in Adamdec1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01691:Adamdec1 APN 14 68573107 missense probably damaging 1.00
IGL02026:Adamdec1 APN 14 68571802 missense possibly damaging 0.81
IGL02068:Adamdec1 APN 14 68577109 missense probably benign 0.21
IGL02416:Adamdec1 APN 14 68572833 missense probably null 0.99
IGL02739:Adamdec1 APN 14 68570156 nonsense probably null
IGL03078:Adamdec1 APN 14 68568850 missense possibly damaging 0.53
IGL03115:Adamdec1 APN 14 68571353 missense probably damaging 1.00
R0201:Adamdec1 UTSW 14 68581957 critical splice donor site probably null
R0243:Adamdec1 UTSW 14 68581958 critical splice donor site probably null
R0244:Adamdec1 UTSW 14 68568723 nonsense probably null
R0416:Adamdec1 UTSW 14 68568712 missense possibly damaging 0.79
R1373:Adamdec1 UTSW 14 68570951 missense probably damaging 1.00
R1856:Adamdec1 UTSW 14 68570948 missense probably damaging 1.00
R2570:Adamdec1 UTSW 14 68579208 missense probably damaging 0.98
R3684:Adamdec1 UTSW 14 68581998 missense probably benign 0.04
R3755:Adamdec1 UTSW 14 68577138 missense probably damaging 1.00
R4450:Adamdec1 UTSW 14 68573119 missense probably benign 0.00
R4661:Adamdec1 UTSW 14 68570113 missense probably damaging 1.00
R4672:Adamdec1 UTSW 14 68577904 nonsense probably null
R4673:Adamdec1 UTSW 14 68577904 nonsense probably null
R4902:Adamdec1 UTSW 14 68571766 missense probably damaging 0.99
R5018:Adamdec1 UTSW 14 68571779 missense probably damaging 1.00
R5141:Adamdec1 UTSW 14 68573128 missense probably benign 0.00
R5329:Adamdec1 UTSW 14 68570163 missense probably damaging 1.00
R5395:Adamdec1 UTSW 14 68570903 missense probably benign 0.04
R5864:Adamdec1 UTSW 14 68570102 missense probably damaging 1.00
R6032:Adamdec1 UTSW 14 68579184 missense probably damaging 1.00
R6032:Adamdec1 UTSW 14 68579184 missense probably damaging 1.00
R6114:Adamdec1 UTSW 14 68571803 missense probably benign 0.00
R6633:Adamdec1 UTSW 14 68573152 missense probably benign 0.03
R7243:Adamdec1 UTSW 14 68571754 missense probably benign 0.06
R7580:Adamdec1 UTSW 14 68565531 missense probably benign 0.00
X0025:Adamdec1 UTSW 14 68570158 missense probably damaging 1.00
X0050:Adamdec1 UTSW 14 68570158 missense probably damaging 1.00
X0062:Adamdec1 UTSW 14 68573252 missense probably benign 0.12
Z1177:Adamdec1 UTSW 14 68580643 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAAAGCTGTACTTGCATTTGGG -3'
(R):5'- GCTGTCCAGAAGATTTTCAGTTTC -3'

Sequencing Primer
(F):5'- GTTTTTGAGTGACCTGGAAGTTC -3'
(R):5'- GTCCAGAAGATTTTCAGTTTCATGAG -3'
Posted On2016-05-10