Incidental Mutation 'R5017:Polr1c'
ID385637
Institutional Source Beutler Lab
Gene Symbol Polr1c
Ensembl Gene ENSMUSG00000067148
Gene Namepolymerase (RNA) I polypeptide C
SynonymsRPA40, Rpo1-1, 40kDa
MMRRC Submission 042608-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5017 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location46243920-46248054 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 46247709 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087026] [ENSMUST00000095263] [ENSMUST00000123311] [ENSMUST00000124655] [ENSMUST00000142706] [ENSMUST00000173232] [ENSMUST00000173349]
Predicted Effect probably benign
Transcript: ENSMUST00000087026
SMART Domains Protein: ENSMUSP00000084252
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
RPOLD 60 339 4.53e-124 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095263
SMART Domains Protein: ENSMUSP00000092897
Gene: ENSMUSG00000071074

DomainStartEndE-ValueType
low complexity region 59 75 N/A INTRINSIC
transmembrane domain 146 168 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
transmembrane domain 212 234 N/A INTRINSIC
transmembrane domain 238 260 N/A INTRINSIC
transmembrane domain 272 294 N/A INTRINSIC
low complexity region 320 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123311
SMART Domains Protein: ENSMUSP00000115951
Gene: ENSMUSG00000071074

DomainStartEndE-ValueType
transmembrane domain 51 73 N/A INTRINSIC
transmembrane domain 88 110 N/A INTRINSIC
transmembrane domain 117 139 N/A INTRINSIC
transmembrane domain 143 165 N/A INTRINSIC
transmembrane domain 177 199 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124126
Predicted Effect probably benign
Transcript: ENSMUST00000124655
SMART Domains Protein: ENSMUSP00000122026
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
RPOLD 1 253 2.14e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127378
SMART Domains Protein: ENSMUSP00000114937
Gene: ENSMUSG00000071074

DomainStartEndE-ValueType
Pfam:Yip1 30 178 4.6e-13 PFAM
low complexity region 189 201 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142706
SMART Domains Protein: ENSMUSP00000116998
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
RPOLD 60 255 9.13e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149989
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152583
Predicted Effect probably benign
Transcript: ENSMUST00000173232
SMART Domains Protein: ENSMUSP00000133597
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
Pfam:RNA_pol_L 61 100 1.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173349
SMART Domains Protein: ENSMUSP00000133861
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
RPOLD 42 170 2.3e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174392
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.1%
  • 3x: 97.0%
  • 10x: 94.3%
  • 20x: 87.9%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of both RNA polymerase I and RNA polymerase III complexes. The encoded protein is part of the Pol core element. Mutations in this gene have been associated with Treacher Collins syndrome (TCS) and hypomyelinating leukodystrophy 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,296,676 F167I unknown Het
Adamdec1 T C 14: 68,573,245 D154G probably benign Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Arhgef3 G T 14: 27,265,530 R20L possibly damaging Het
Birc2 A T 9: 7,818,885 C568* probably null Het
Cep44 A G 8: 56,544,207 S99P possibly damaging Het
Clstn2 A G 9: 97,483,086 W456R probably damaging Het
Cog5 T A 12: 31,920,605 S783T probably benign Het
Endod1 G A 9: 14,356,891 R433* probably null Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gdpd4 C A 7: 98,004,275 Y498* probably null Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Hapln2 A G 3: 88,024,001 V69A probably damaging Het
Ifit3 A C 19: 34,587,192 N46T possibly damaging Het
Kcnh8 T C 17: 52,893,930 L464S probably damaging Het
Lrrc9 C A 12: 72,506,325 R1334S possibly damaging Het
Macf1 A G 4: 123,452,113 F2631L probably damaging Het
Mafa T C 15: 75,747,489 H145R probably benign Het
Muc6 T C 7: 141,640,528 T1411A probably benign Het
Nos3 A G 5: 24,366,719 probably benign Het
Nwd2 T A 5: 63,650,141 probably benign Het
Olfr160 A T 9: 37,711,525 Y251* probably null Het
Olfr44 A T 9: 39,484,755 M166K possibly damaging Het
Olfr981 A T 9: 40,022,376 probably benign Het
Pde11a A T 2: 76,136,367 D579E probably benign Het
Phkb A T 8: 86,049,809 H954L probably benign Het
Phldb3 C T 7: 24,620,096 T353M probably damaging Het
Pigu A T 2: 155,299,208 probably null Het
Pla2r1 A G 2: 60,522,760 probably null Het
Setbp1 C A 18: 78,856,594 G1286V possibly damaging Het
Siglecg T A 7: 43,411,386 probably benign Het
Slc25a46 A T 18: 31,605,783 H118Q probably damaging Het
Sycp1 A T 3: 102,895,987 probably null Het
Tmem132c A G 5: 127,563,350 T862A probably benign Het
Tmem256 T C 11: 69,838,992 probably benign Het
Tpr A T 1: 150,398,637 E98D probably benign Het
Trdn A G 10: 33,468,159 D623G probably benign Het
Trip11 T C 12: 101,846,620 N1485S probably benign Het
Trpm1 T C 7: 64,244,832 probably benign Het
Uhrf1bp1 T A 17: 27,894,739 L1295* probably null Het
Vmn1r227 T C 17: 20,736,078 noncoding transcript Het
Xpo6 G A 7: 126,104,747 A21V probably benign Het
Zfp276 A G 8: 123,264,977 probably benign Het
Other mutations in Polr1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Polr1c APN 17 46244209 missense probably damaging 1.00
IGL02035:Polr1c APN 17 46246159 missense possibly damaging 0.72
R0068:Polr1c UTSW 17 46244903 missense probably benign 0.00
R0457:Polr1c UTSW 17 46247763 missense probably benign 0.00
R0828:Polr1c UTSW 17 46245064 missense probably damaging 0.96
R0881:Polr1c UTSW 17 46244613 missense possibly damaging 0.69
R1322:Polr1c UTSW 17 46244163 missense possibly damaging 0.74
R1518:Polr1c UTSW 17 46247895 missense possibly damaging 0.89
R3765:Polr1c UTSW 17 46247924 missense probably damaging 0.99
R4212:Polr1c UTSW 17 46246120 missense probably damaging 0.97
R4548:Polr1c UTSW 17 46247809 splice site probably null
R5018:Polr1c UTSW 17 46247709 intron probably benign
R5039:Polr1c UTSW 17 46247709 intron probably benign
R5167:Polr1c UTSW 17 46247709 intron probably benign
R5168:Polr1c UTSW 17 46247709 intron probably benign
R5971:Polr1c UTSW 17 46247709 intron probably benign
R6979:Polr1c UTSW 17 46246169 missense probably damaging 1.00
R7812:Polr1c UTSW 17 46246127 missense probably damaging 1.00
R7869:Polr1c UTSW 17 46244891 missense probably benign 0.00
R7952:Polr1c UTSW 17 46244891 missense probably benign 0.00
R8025:Polr1c UTSW 17 46245048 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGGATTCAGTGCATCAATG -3'
(R):5'- GGTTCGCAATGTAAGAGATCGG -3'

Sequencing Primer
(F):5'- AGTGCATCAATGATTCCTGACC -3'
(R):5'- CAATGTAAGAGATCGGGGCGC -3'
Posted On2016-05-10