Incidental Mutation 'R5017:Fchsd1'
ID385640
Institutional Source Beutler Lab
Gene Symbol Fchsd1
Ensembl Gene ENSMUSG00000038524
Gene NameFCH and double SH3 domains 1
SynonymsA030002D08Rik
MMRRC Submission 042608-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R5017 (G1)
Quality Score209
Status Validated
Chromosome18
Chromosomal Location37957431-37969774 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 37959873 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043437] [ENSMUST00000043498] [ENSMUST00000070709] [ENSMUST00000091932] [ENSMUST00000163128] [ENSMUST00000163591] [ENSMUST00000168056] [ENSMUST00000169360] [ENSMUST00000169498] [ENSMUST00000176104] [ENSMUST00000176902] [ENSMUST00000177058]
Predicted Effect probably benign
Transcript: ENSMUST00000043437
SMART Domains Protein: ENSMUSP00000047878
Gene: ENSMUSG00000038524

DomainStartEndE-ValueType
Pfam:FCH 21 100 1.6e-19 PFAM
coiled coil region 188 209 N/A INTRINSIC
low complexity region 346 357 N/A INTRINSIC
SH3 469 526 1.34e-8 SMART
SH3 547 606 1.94e-14 SMART
low complexity region 622 634 N/A INTRINSIC
low complexity region 657 686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043498
SMART Domains Protein: ENSMUSP00000037981
Gene: ENSMUSG00000024454

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 11 315 1.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070709
SMART Domains Protein: ENSMUSP00000070280
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 1.2e-22 PFAM
low complexity region 194 212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091932
SMART Domains Protein: ENSMUSP00000089552
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 8.3e-23 PFAM
low complexity region 194 212 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153945
Predicted Effect probably benign
Transcript: ENSMUST00000163128
SMART Domains Protein: ENSMUSP00000127234
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 5.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163591
SMART Domains Protein: ENSMUSP00000129299
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
low complexity region 103 121 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165643
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166727
Predicted Effect probably benign
Transcript: ENSMUST00000168056
SMART Domains Protein: ENSMUSP00000130051
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 1.9e-23 PFAM
low complexity region 104 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169360
SMART Domains Protein: ENSMUSP00000129880
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 4.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169498
SMART Domains Protein: ENSMUSP00000128949
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
low complexity region 103 121 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176104
SMART Domains Protein: ENSMUSP00000135556
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 60 3.3e-22 PFAM
low complexity region 194 212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176902
SMART Domains Protein: ENSMUSP00000135176
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
low complexity region 103 121 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177058
SMART Domains Protein: ENSMUSP00000135615
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 1.2e-22 PFAM
low complexity region 194 212 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.1%
  • 3x: 97.0%
  • 10x: 94.3%
  • 20x: 87.9%
Validation Efficiency 96% (46/48)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,296,676 F167I unknown Het
Adamdec1 T C 14: 68,573,245 D154G probably benign Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Arhgef3 G T 14: 27,265,530 R20L possibly damaging Het
Birc2 A T 9: 7,818,885 C568* probably null Het
Cep44 A G 8: 56,544,207 S99P possibly damaging Het
Clstn2 A G 9: 97,483,086 W456R probably damaging Het
Cog5 T A 12: 31,920,605 S783T probably benign Het
Endod1 G A 9: 14,356,891 R433* probably null Het
Gdpd4 C A 7: 98,004,275 Y498* probably null Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Hapln2 A G 3: 88,024,001 V69A probably damaging Het
Ifit3 A C 19: 34,587,192 N46T possibly damaging Het
Kcnh8 T C 17: 52,893,930 L464S probably damaging Het
Lrrc9 C A 12: 72,506,325 R1334S possibly damaging Het
Macf1 A G 4: 123,452,113 F2631L probably damaging Het
Mafa T C 15: 75,747,489 H145R probably benign Het
Muc6 T C 7: 141,640,528 T1411A probably benign Het
Nos3 A G 5: 24,366,719 probably benign Het
Nwd2 T A 5: 63,650,141 probably benign Het
Olfr160 A T 9: 37,711,525 Y251* probably null Het
Olfr44 A T 9: 39,484,755 M166K possibly damaging Het
Olfr981 A T 9: 40,022,376 probably benign Het
Pde11a A T 2: 76,136,367 D579E probably benign Het
Phkb A T 8: 86,049,809 H954L probably benign Het
Phldb3 C T 7: 24,620,096 T353M probably damaging Het
Pigu A T 2: 155,299,208 probably null Het
Pla2r1 A G 2: 60,522,760 probably null Het
Polr1c G T 17: 46,247,709 probably benign Het
Setbp1 C A 18: 78,856,594 G1286V possibly damaging Het
Siglecg T A 7: 43,411,386 probably benign Het
Slc25a46 A T 18: 31,605,783 H118Q probably damaging Het
Sycp1 A T 3: 102,895,987 probably null Het
Tmem132c A G 5: 127,563,350 T862A probably benign Het
Tmem256 T C 11: 69,838,992 probably benign Het
Tpr A T 1: 150,398,637 E98D probably benign Het
Trdn A G 10: 33,468,159 D623G probably benign Het
Trip11 T C 12: 101,846,620 N1485S probably benign Het
Trpm1 T C 7: 64,244,832 probably benign Het
Uhrf1bp1 T A 17: 27,894,739 L1295* probably null Het
Vmn1r227 T C 17: 20,736,078 noncoding transcript Het
Xpo6 G A 7: 126,104,747 A21V probably benign Het
Zfp276 A G 8: 123,264,977 probably benign Het
Other mutations in Fchsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Fchsd1 APN 18 37965893 intron probably benign
IGL01097:Fchsd1 APN 18 37967757 splice site probably null
IGL02069:Fchsd1 APN 18 37967614 nonsense probably null
R0015:Fchsd1 UTSW 18 37962959 missense probably benign 0.05
R0015:Fchsd1 UTSW 18 37962959 missense probably benign 0.05
R0755:Fchsd1 UTSW 18 37968750 splice site probably null
R1524:Fchsd1 UTSW 18 37965897 critical splice donor site probably null
R2041:Fchsd1 UTSW 18 37967676 critical splice acceptor site probably null
R3820:Fchsd1 UTSW 18 37969457 splice site probably benign
R3821:Fchsd1 UTSW 18 37969457 splice site probably benign
R4998:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5018:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5022:Fchsd1 UTSW 18 37964810 missense possibly damaging 0.80
R5023:Fchsd1 UTSW 18 37964810 missense possibly damaging 0.80
R5047:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5240:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5309:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5312:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5353:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5354:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5355:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5424:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5517:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5518:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5521:Fchsd1 UTSW 18 37966484 missense probably damaging 1.00
R5590:Fchsd1 UTSW 18 37961327 missense probably damaging 1.00
R5607:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5608:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5810:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5828:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5906:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5949:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5958:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5969:Fchsd1 UTSW 18 37959873 unclassified probably benign
R6245:Fchsd1 UTSW 18 37962775 missense probably damaging 1.00
R6322:Fchsd1 UTSW 18 37965700 missense probably benign 0.00
R6433:Fchsd1 UTSW 18 37964084 missense possibly damaging 0.91
R6439:Fchsd1 UTSW 18 37969434 missense probably damaging 0.97
R6460:Fchsd1 UTSW 18 37959844 splice site probably null
R6488:Fchsd1 UTSW 18 37967268 intron probably null
R6650:Fchsd1 UTSW 18 37966502 nonsense probably null
R7331:Fchsd1 UTSW 18 37968770 missense possibly damaging 0.95
X0024:Fchsd1 UTSW 18 37969391 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAGTCTGTCTTAGGAATATCCCTG -3'
(R):5'- ATAGGCATTTTGAGGGGCAG -3'

Sequencing Primer
(F):5'- GTCTTAGGAATATCCCTGACAATTC -3'
(R):5'- TTTATAGCTTAGGCTGCTG -3'
Posted On2016-05-10