Mutagenetix > Incidental Mutation

Incidental Mutation 'S24628:Zap70'

385643

Institutional Source

Beutler Lab

Gene Symbol

Zap70

Ensembl Gene

ENSMUSG00000026117

Gene Name

zeta-chain (TCR) associated protein kinase

Synonyms

ZAP-70, TZK, Srk

Accession Numbers

Genbank: NM_009539; MGI: 99613

Is this an essential gene?

Probably non essential (E-score: 0.174) question?

Stock #

S24628 () of strain waterfowl

Quality Score

222

Status

Not validated

Chromosome

Chromosomal Location

36761798-36782818 bp(+) (GRCm38)

Type of Mutation

start codon destroyed

DNA Base Change (assembly)

A to G at 36770811 bp (GRCm38)

Zygosity

Homozygous

Amino Acid Change

Methionine to Valine at position 1 (M1V)

Ref Sequence

ENSEMBL: ENSMUSP00000027291 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027291] [ENSMUST00000185871]

AlphaFold

P43404

Predicted Effect

probably null
Transcript: ENSMUST00000027291
AA Change: M1V

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000027291
Gene: ENSMUSG00000026117
AA Change: M1V

Domain	Start	End	E-Value	Type
SH2	8	93	6.73e-25	SMART
SH2	161	245	1.59e-26	SMART
low complexity region	257	265	N/A	INTRINSIC
TyrKc	337	592	1e-128	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180475

Predicted Effect

probably null
Transcript: ENSMUST00000185871
AA Change: M1V

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000139990
Gene: ENSMUSG00000026117
AA Change: M1V

Domain	Start	End	E-Value	Type
SH2	8	85	1.9e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186624

Meta Mutation Damage Score

0.8637

Coding Region Coverage

1x: 98.1%
3x: 97.0%
10x: 94.3%
20x: 88.0%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the protein tyrosine kinase family. The encoded protein is essential for development of T lymphocytes and thymocytes, and functions in the initial step of T lymphocyte receptor-mediated signal transduction. A mutation in this gene causes chronic autoimmune arthritis, similar to rheumatoid arthritis in humans. Mice lacking this gene are deficient in alpha-beta T lymphocytes in the thymus. In humans, mutations in this gene cause selective T-cell defect, a severe combined immunodeficiency disease characterized by a selective absence of CD8-positive T lymphocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mutant mice show T cell defects. Null mutants lack alpha-beta T cells in the thymus and have fewer T cells in dendritic and intestinal epithelium. Spontaneous and knock-in missense mutations affect T cell receptor signaling, one of the former resulting in severe chronic arthritis. [provided by MGI curators]

Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Targeted, other(7) Gene trapped(1) Spontaneous(2) Chemically induced(3)

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgre4	G	A	17: 55,852,288	V658I	probably benign	Het
Ccdc40	T	C	11: 119,232,118	Y249H	possibly damaging	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Homo
Gbp4	G	A	5: 105,121,106	R394C	possibly damaging	Het
Gpr183	C	A	14: 121,954,476	C211F	probably damaging	Homo
Lcp1	A	T	14: 75,227,006	I556F	possibly damaging	Het
Letm1	G	A	5: 33,747,444	P513S	probably benign	Het
Letm1	G	A	5: 33,747,446	P512L	probably benign	Het
Msh3	A	G	13: 92,346,786	V283A	possibly damaging	Het
Nfkb2	G	T	19: 46,307,567	E170D	probably benign	Het
Npr3	C	A	15: 11,848,563	M439I	probably benign	Het
Olfr1023	A	T	2: 85,887,438	I213F	possibly damaging	Het
Olfr1034	A	T	2: 86,047,055	H191L	probably benign	Het
Pax5	G	A	4: 44,691,886	A120V	probably damaging	Het
Plcb1	A	G	2: 135,337,499	Y609C	probably damaging	Het
Plxna1	G	A	6: 89,357,336	H104Y	probably benign	Homo
Rnf213	A	T	11: 119,414,469	I509F	probably damaging	Het
Ryr2	T	C	13: 11,869,156	S213G	probably damaging	Homo
Spint1	A	G	2: 119,245,615	T231A	probably damaging	Het
Tbcel	C	A	9: 42,444,500	C139F	probably benign	Het
Thbs2	A	C	17: 14,679,973	S573A	probably benign	Het
Tmem43	C	A	6: 91,482,318	P257Q	probably benign	Homo
Tmprss13	A	G	9: 45,337,132		probably null	Het
Tnc	C	T	4: 64,018,012	G229D	probably damaging	Homo
Ugt1a10	TTCATCA	TTCA	1: 88,216,158		probably benign	Het
Vmn1r196	T	A	13: 22,293,836	V215D	probably damaging	Homo
Vmn1r22	G	T	6: 57,900,332	T220K	probably benign	Homo
Vmn2r116	G	A	17: 23,387,279	M388I	possibly damaging	Het
Zfp282	A	G	6: 47,897,881	D340G	probably damaging	Homo
Zfp282	T	A	6: 47,905,053	I558N	possibly damaging	Homo

Other mutations in Zap70

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
mrtless	APN	1	36781149	missense	probably damaging	1.00
murdock	APN	1	36779704	missense	probably damaging	0.99
IGL00763:Zap70	APN	1	36779252	missense	possibly damaging	0.81
IGL01635:Zap70	APN	1	36771157	missense	probably damaging	0.99
IGL01918:Zap70	APN	1	36778787	missense	possibly damaging	0.64
IGL02164:Zap70	APN	1	36771186	missense	probably damaging	0.99
IGL02502:Zap70	APN	1	36778806	splice site	probably benign
IGL02597:Zap70	APN	1	36771920	nonsense	probably null
IGL03026:Zap70	APN	1	36779717	missense	possibly damaging	0.94
biscayne	UTSW	1	36781412	missense	probably damaging	1.00
mesa_verde	UTSW	1	36779173	missense	probably damaging	1.00
shazzam	UTSW	1	36781137	missense	probably damaging	1.00
trebia	UTSW	1	36781025	missense	probably damaging	1.00
wanna	UTSW	1	36770983	missense	probably damaging	1.00
wanna2	UTSW	1	36781412	missense	probably damaging	1.00
wanna3	UTSW	1	36778218	missense	probably damaging	0.99
wanna4	UTSW	1	36781365	missense	probably damaging	1.00
want_to	UTSW	1	36782517	missense	probably damaging	1.00
waterfowl	UTSW	1	36770811	start codon destroyed	probably null	0.03
zapatos	UTSW	1	36771181	missense	possibly damaging	0.89
zipper	UTSW	1	36770902	missense	probably benign	0.09
PIT1430001:Zap70	UTSW	1	36779169	missense	possibly damaging	0.95
R0487:Zap70	UTSW	1	36779284	missense	probably damaging	1.00
R0701:Zap70	UTSW	1	36781177	missense	probably damaging	1.00
R0960:Zap70	UTSW	1	36779173	missense	probably damaging	1.00
R1520:Zap70	UTSW	1	36770955	missense	probably damaging	1.00
R2064:Zap70	UTSW	1	36779134	missense	probably benign
R3623:Zap70	UTSW	1	36779135	missense	probably benign	0.03
R3689:Zap70	UTSW	1	36781412	missense	probably damaging	1.00
R3690:Zap70	UTSW	1	36781412	missense	probably damaging	1.00
R3804:Zap70	UTSW	1	36771142	missense	possibly damaging	0.58
R3840:Zap70	UTSW	1	36778417	missense	probably damaging	1.00
R4260:Zap70	UTSW	1	36779108	splice site	probably benign
R4383:Zap70	UTSW	1	36780961	missense	probably damaging	1.00
R4632:Zap70	UTSW	1	36778458	missense	probably benign
R4783:Zap70	UTSW	1	36779173	missense	probably damaging	1.00
R5051:Zap70	UTSW	1	36781451	missense	probably benign	0.00
R5271:Zap70	UTSW	1	36781365	missense	probably damaging	1.00
R5304:Zap70	UTSW	1	36778218	missense	probably damaging	0.99
R5792:Zap70	UTSW	1	36779009	intron	probably benign
R5932:Zap70	UTSW	1	36781146	missense	probably damaging	1.00
R5941:Zap70	UTSW	1	36770949	missense	probably damaging	1.00
R6694:Zap70	UTSW	1	36782517	missense	probably damaging	1.00
R6825:Zap70	UTSW	1	36778390	missense	probably damaging	1.00
R7039:Zap70	UTSW	1	36778751	missense	probably benign
R7704:Zap70	UTSW	1	36779314	critical splice donor site	probably null
R7769:Zap70	UTSW	1	36770902	missense	probably benign	0.09
R8115:Zap70	UTSW	1	36781206	missense	probably damaging	1.00
R8140:Zap70	UTSW	1	36771181	missense	possibly damaging	0.89
R8289:Zap70	UTSW	1	36781137	missense	probably damaging	1.00
R9186:Zap70	UTSW	1	36779751	missense	possibly damaging	0.66
R9540:Zap70	UTSW	1	36778788	missense	possibly damaging	0.95
R9654:Zap70	UTSW	1	36779246	missense	probably benign	0.03
R9674:Zap70	UTSW	1	36771069	missense	probably benign	0.10
Z1176:Zap70	UTSW	1	36779176	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GTCACGCCTATCACACTATTGACC -3'
(R):5'- AAATGGTGGAAGCGCACGTC -3'

Sequencing Primer
(F):5'- GACATATCTTTGGAAACTGAAGGGTC -3'
(R):5'- GTCGTGCACCAACGACAG -3'

Posted On

2016-05-10