Incidental Mutation 'S24628:Zap70'
ID 385643
Institutional Source Beutler Lab
Gene Symbol Zap70
Ensembl Gene ENSMUSG00000026117
Gene Name zeta-chain (TCR) associated protein kinase
Synonyms ZAP-70, TZK, Srk
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.322) question?
Stock # S24628 () of strain waterfowl
Quality Score 222
Status Not validated
Chromosome 1
Chromosomal Location 36800879-36821899 bp(+) (GRCm39)
Type of Mutation start codon destroyed
DNA Base Change (assembly) A to G at 36809892 bp (GRCm39)
Zygosity Homozygous
Amino Acid Change Methionine to Valine at position 1 (M1V)
Ref Sequence ENSEMBL: ENSMUSP00000027291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027291] [ENSMUST00000185871]
AlphaFold P43404
Predicted Effect probably null
Transcript: ENSMUST00000027291
AA Change: M1V

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000027291
Gene: ENSMUSG00000026117
AA Change: M1V

DomainStartEndE-ValueType
SH2 8 93 6.73e-25 SMART
SH2 161 245 1.59e-26 SMART
low complexity region 257 265 N/A INTRINSIC
TyrKc 337 592 1e-128 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180475
Predicted Effect probably null
Transcript: ENSMUST00000185871
AA Change: M1V

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000139990
Gene: ENSMUSG00000026117
AA Change: M1V

DomainStartEndE-ValueType
SH2 8 85 1.9e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186624
Meta Mutation Damage Score 0.8637 question?
Coding Region Coverage
  • 1x: 98.1%
  • 3x: 97.0%
  • 10x: 94.3%
  • 20x: 88.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the protein tyrosine kinase family. The encoded protein is essential for development of T lymphocytes and thymocytes, and functions in the initial step of T lymphocyte receptor-mediated signal transduction. A mutation in this gene causes chronic autoimmune arthritis, similar to rheumatoid arthritis in humans. Mice lacking this gene are deficient in alpha-beta T lymphocytes in the thymus. In humans, mutations in this gene cause selective T-cell defect, a severe combined immunodeficiency disease characterized by a selective absence of CD8-positive T lymphocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mutant mice show T cell defects. Null mutants lack alpha-beta T cells in the thymus and have fewer T cells in dendritic and intestinal epithelium. Spontaneous and knock-in missense mutations affect T cell receptor signaling, one of the former resulting in severe chronic arthritis. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Targeted, other(7) Gene trapped(1) Spontaneous(2) Chemically induced(3)

Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 G A 17: 56,159,288 (GRCm39) V658I probably benign Het
Ccdc40 T C 11: 119,122,944 (GRCm39) Y249H possibly damaging Het
D6Ertd527e C G 6: 87,088,506 (GRCm39) T223S unknown Homo
Gbp4 G A 5: 105,268,972 (GRCm39) R394C possibly damaging Het
Gpr183 C A 14: 122,191,888 (GRCm39) C211F probably damaging Homo
Lcp1 A T 14: 75,464,446 (GRCm39) I556F possibly damaging Het
Letm1 G A 5: 33,904,788 (GRCm39) P513S probably benign Het
Letm1 G A 5: 33,904,790 (GRCm39) P512L probably benign Het
Msh3 A G 13: 92,483,294 (GRCm39) V283A possibly damaging Het
Nfkb2 G T 19: 46,296,006 (GRCm39) E170D probably benign Het
Npr3 C A 15: 11,848,649 (GRCm39) M439I probably benign Het
Or5m10 A T 2: 85,717,782 (GRCm39) I213F possibly damaging Het
Or5m9 A T 2: 85,877,399 (GRCm39) H191L probably benign Het
Pax5 G A 4: 44,691,886 (GRCm39) A120V probably damaging Het
Plcb1 A G 2: 135,179,419 (GRCm39) Y609C probably damaging Het
Plxna1 G A 6: 89,334,318 (GRCm39) H104Y probably benign Homo
Rnf213 A T 11: 119,305,295 (GRCm39) I509F probably damaging Het
Ryr2 T C 13: 11,884,042 (GRCm39) S213G probably damaging Homo
Spint1 A G 2: 119,076,096 (GRCm39) T231A probably damaging Het
Tbcel C A 9: 42,355,796 (GRCm39) C139F probably benign Het
Thbs2 A C 17: 14,900,235 (GRCm39) S573A probably benign Het
Tmem43 C A 6: 91,459,300 (GRCm39) P257Q probably benign Homo
Tmprss13 A G 9: 45,248,430 (GRCm39) probably null Het
Tnc C T 4: 63,936,249 (GRCm39) G229D probably damaging Homo
Ugt1a10 TTCATCA TTCA 1: 88,143,880 (GRCm39) probably benign Het
Vmn1r196 T A 13: 22,478,006 (GRCm39) V215D probably damaging Homo
Vmn1r22 G T 6: 57,877,317 (GRCm39) T220K probably benign Homo
Vmn2r116 G A 17: 23,606,253 (GRCm39) M388I possibly damaging Het
Zfp282 A G 6: 47,874,815 (GRCm39) D340G probably damaging Homo
Zfp282 T A 6: 47,881,987 (GRCm39) I558N possibly damaging Homo
Other mutations in Zap70
AlleleSourceChrCoordTypePredicted EffectPPH Score
mrtless APN 1 36,820,230 (GRCm39) missense probably damaging 1.00
murdock APN 1 36,818,785 (GRCm39) missense probably damaging 0.99
IGL00763:Zap70 APN 1 36,818,333 (GRCm39) missense possibly damaging 0.81
IGL01635:Zap70 APN 1 36,810,238 (GRCm39) missense probably damaging 0.99
IGL01918:Zap70 APN 1 36,817,868 (GRCm39) missense possibly damaging 0.64
IGL02164:Zap70 APN 1 36,810,267 (GRCm39) missense probably damaging 0.99
IGL02502:Zap70 APN 1 36,817,887 (GRCm39) splice site probably benign
IGL02597:Zap70 APN 1 36,811,001 (GRCm39) nonsense probably null
IGL03026:Zap70 APN 1 36,818,798 (GRCm39) missense possibly damaging 0.94
biscayne UTSW 1 36,820,493 (GRCm39) missense probably damaging 1.00
mesa_verde UTSW 1 36,818,254 (GRCm39) missense probably damaging 1.00
shazzam UTSW 1 36,820,218 (GRCm39) missense probably damaging 1.00
trebia UTSW 1 36,820,106 (GRCm39) missense probably damaging 1.00
wanna UTSW 1 36,810,064 (GRCm39) missense probably damaging 1.00
wanna2 UTSW 1 36,820,493 (GRCm39) missense probably damaging 1.00
wanna3 UTSW 1 36,817,299 (GRCm39) missense probably damaging 0.99
wanna4 UTSW 1 36,820,446 (GRCm39) missense probably damaging 1.00
want_to UTSW 1 36,821,598 (GRCm39) missense probably damaging 1.00
waterfowl UTSW 1 36,809,892 (GRCm39) start codon destroyed probably null 0.03
zapatos UTSW 1 36,810,262 (GRCm39) missense possibly damaging 0.89
zipper UTSW 1 36,809,983 (GRCm39) missense probably benign 0.09
PIT1430001:Zap70 UTSW 1 36,818,250 (GRCm39) missense possibly damaging 0.95
R0487:Zap70 UTSW 1 36,818,365 (GRCm39) missense probably damaging 1.00
R0701:Zap70 UTSW 1 36,820,258 (GRCm39) missense probably damaging 1.00
R0960:Zap70 UTSW 1 36,818,254 (GRCm39) missense probably damaging 1.00
R1520:Zap70 UTSW 1 36,810,036 (GRCm39) missense probably damaging 1.00
R2064:Zap70 UTSW 1 36,818,215 (GRCm39) missense probably benign
R3623:Zap70 UTSW 1 36,818,216 (GRCm39) missense probably benign 0.03
R3689:Zap70 UTSW 1 36,820,493 (GRCm39) missense probably damaging 1.00
R3690:Zap70 UTSW 1 36,820,493 (GRCm39) missense probably damaging 1.00
R3804:Zap70 UTSW 1 36,810,223 (GRCm39) missense possibly damaging 0.58
R3840:Zap70 UTSW 1 36,817,498 (GRCm39) missense probably damaging 1.00
R4260:Zap70 UTSW 1 36,818,189 (GRCm39) splice site probably benign
R4383:Zap70 UTSW 1 36,820,042 (GRCm39) missense probably damaging 1.00
R4632:Zap70 UTSW 1 36,817,539 (GRCm39) missense probably benign
R4783:Zap70 UTSW 1 36,818,254 (GRCm39) missense probably damaging 1.00
R5051:Zap70 UTSW 1 36,820,532 (GRCm39) missense probably benign 0.00
R5271:Zap70 UTSW 1 36,820,446 (GRCm39) missense probably damaging 1.00
R5304:Zap70 UTSW 1 36,817,299 (GRCm39) missense probably damaging 0.99
R5792:Zap70 UTSW 1 36,818,090 (GRCm39) intron probably benign
R5932:Zap70 UTSW 1 36,820,227 (GRCm39) missense probably damaging 1.00
R5941:Zap70 UTSW 1 36,810,030 (GRCm39) missense probably damaging 1.00
R6694:Zap70 UTSW 1 36,821,598 (GRCm39) missense probably damaging 1.00
R6825:Zap70 UTSW 1 36,817,471 (GRCm39) missense probably damaging 1.00
R7039:Zap70 UTSW 1 36,817,832 (GRCm39) missense probably benign
R7704:Zap70 UTSW 1 36,818,395 (GRCm39) critical splice donor site probably null
R7769:Zap70 UTSW 1 36,809,983 (GRCm39) missense probably benign 0.09
R8115:Zap70 UTSW 1 36,820,287 (GRCm39) missense probably damaging 1.00
R8140:Zap70 UTSW 1 36,810,262 (GRCm39) missense possibly damaging 0.89
R8289:Zap70 UTSW 1 36,820,218 (GRCm39) missense probably damaging 1.00
R9186:Zap70 UTSW 1 36,818,832 (GRCm39) missense possibly damaging 0.66
R9540:Zap70 UTSW 1 36,817,869 (GRCm39) missense possibly damaging 0.95
R9654:Zap70 UTSW 1 36,818,327 (GRCm39) missense probably benign 0.03
R9674:Zap70 UTSW 1 36,810,150 (GRCm39) missense probably benign 0.10
Z1176:Zap70 UTSW 1 36,818,257 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCACGCCTATCACACTATTGACC -3'
(R):5'- AAATGGTGGAAGCGCACGTC -3'

Sequencing Primer
(F):5'- GACATATCTTTGGAAACTGAAGGGTC -3'
(R):5'- GTCGTGCACCAACGACAG -3'
Posted On 2016-05-10