Incidental Mutation 'S24628:Olfr1023'
ID 385645
Institutional Source Beutler Lab
Gene Symbol Olfr1023
Ensembl Gene ENSMUSG00000050128
Gene Name olfactory receptor 1023
Synonyms MOR196-3, GA_x6K02T2Q125-47363965-47364900
Accession Numbers
Essential gene? Probably non essential (E-score: 0.066) question?
Stock # S24628 () of strain waterfowl
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 85885640-85891213 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 85887438 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 213 (I213F)
Ref Sequence ENSEMBL: ENSMUSP00000149138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056408] [ENSMUST00000213441]
AlphaFold A2ASU6
Predicted Effect possibly damaging
Transcript: ENSMUST00000056408
AA Change: I213F

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000059849
Gene: ENSMUSG00000050128
AA Change: I213F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.6e-52 PFAM
Pfam:7TM_GPCR_Srsx 35 304 2.6e-7 PFAM
Pfam:7tm_1 41 290 2.4e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082871
Predicted Effect possibly damaging
Transcript: ENSMUST00000213441
AA Change: I213F

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.2485 question?
Coding Region Coverage
  • 1x: 98.1%
  • 3x: 97.0%
  • 10x: 94.3%
  • 20x: 88.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 G A 17: 55,852,288 V658I probably benign Het
Ccdc40 T C 11: 119,232,118 Y249H possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Homo
Gbp4 G A 5: 105,121,106 R394C possibly damaging Het
Gpr183 C A 14: 121,954,476 C211F probably damaging Homo
Lcp1 A T 14: 75,227,006 I556F possibly damaging Het
Letm1 G A 5: 33,747,444 P513S probably benign Het
Letm1 G A 5: 33,747,446 P512L probably benign Het
Msh3 A G 13: 92,346,786 V283A possibly damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Npr3 C A 15: 11,848,563 M439I probably benign Het
Olfr1034 A T 2: 86,047,055 H191L probably benign Het
Pax5 G A 4: 44,691,886 A120V probably damaging Het
Plcb1 A G 2: 135,337,499 Y609C probably damaging Het
Plxna1 G A 6: 89,357,336 H104Y probably benign Homo
Rnf213 A T 11: 119,414,469 I509F probably damaging Het
Ryr2 T C 13: 11,869,156 S213G probably damaging Homo
Spint1 A G 2: 119,245,615 T231A probably damaging Het
Tbcel C A 9: 42,444,500 C139F probably benign Het
Thbs2 A C 17: 14,679,973 S573A probably benign Het
Tmem43 C A 6: 91,482,318 P257Q probably benign Homo
Tmprss13 A G 9: 45,337,132 probably null Het
Tnc C T 4: 64,018,012 G229D probably damaging Homo
Ugt1a10 TTCATCA TTCA 1: 88,216,158 probably benign Het
Vmn1r196 T A 13: 22,293,836 V215D probably damaging Homo
Vmn1r22 G T 6: 57,900,332 T220K probably benign Homo
Vmn2r116 G A 17: 23,387,279 M388I possibly damaging Het
Zap70 A G 1: 36,770,811 M1V probably null Homo
Zfp282 A G 6: 47,897,881 D340G probably damaging Homo
Zfp282 T A 6: 47,905,053 I558N possibly damaging Homo
Other mutations in Olfr1023
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01536:Olfr1023 APN 2 85887600 missense probably damaging 1.00
IGL01622:Olfr1023 APN 2 85886962 missense probably benign 0.01
IGL01623:Olfr1023 APN 2 85886962 missense probably benign 0.01
IGL01977:Olfr1023 APN 2 85887367 missense probably damaging 1.00
IGL02057:Olfr1023 APN 2 85886931 missense probably benign 0.00
IGL02555:Olfr1023 APN 2 85887398 missense probably benign 0.34
IGL03133:Olfr1023 APN 2 85887134 missense probably damaging 1.00
IGL03180:Olfr1023 APN 2 85887396 missense probably benign 0.00
R0415:Olfr1023 UTSW 2 85887438 missense possibly damaging 0.94
R1476:Olfr1023 UTSW 2 85887248 nonsense probably null
R1544:Olfr1023 UTSW 2 85887271 missense probably damaging 1.00
R2058:Olfr1023 UTSW 2 85886952 missense possibly damaging 0.48
R4096:Olfr1023 UTSW 2 85887423 missense probably damaging 0.98
R5055:Olfr1023 UTSW 2 85887241 missense probably benign 0.12
R5703:Olfr1023 UTSW 2 85887439 missense probably benign 0.06
R6297:Olfr1023 UTSW 2 85886815 missense probably benign 0.35
R7041:Olfr1023 UTSW 2 85887621 missense probably benign 0.01
R7070:Olfr1023 UTSW 2 85887690 missense probably benign 0.13
R7563:Olfr1023 UTSW 2 85887138 missense probably damaging 0.98
R7777:Olfr1023 UTSW 2 85887607 missense possibly damaging 0.83
R7913:Olfr1023 UTSW 2 85887730 missense probably damaging 0.96
R9060:Olfr1023 UTSW 2 85887576 missense probably benign 0.06
R9789:Olfr1023 UTSW 2 85886994 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATGGGCTGTCTCAGACTCTG -3'
(R):5'- GATCAAGGGGTTCAACATTGG -3'

Sequencing Primer
(F):5'- GGCTGTCTCAGACTCTGCTCAC -3'
(R):5'- TGCAATTACTTTTGACTCTTCTACAG -3'
Posted On 2016-05-10