Incidental Mutation 'S24628:Or5m10'
ID 385645
Institutional Source Beutler Lab
Gene Symbol Or5m10
Ensembl Gene ENSMUSG00000050128
Gene Name olfactory receptor family 5 subfamily M member 10
Synonyms GA_x6K02T2Q125-47363965-47364900, MOR196-3, Olfr1023
Accession Numbers
Essential gene? Probably non essential (E-score: 0.066) question?
Stock # S24628 () of strain waterfowl
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 85717146-85718081 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 85717782 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 213 (I213F)
Ref Sequence ENSEMBL: ENSMUSP00000149138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056408] [ENSMUST00000213441]
AlphaFold A2ASU6
Predicted Effect possibly damaging
Transcript: ENSMUST00000056408
AA Change: I213F

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000059849
Gene: ENSMUSG00000050128
AA Change: I213F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.6e-52 PFAM
Pfam:7TM_GPCR_Srsx 35 304 2.6e-7 PFAM
Pfam:7tm_1 41 290 2.4e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082871
Predicted Effect possibly damaging
Transcript: ENSMUST00000213441
AA Change: I213F

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.2485 question?
Coding Region Coverage
  • 1x: 98.1%
  • 3x: 97.0%
  • 10x: 94.3%
  • 20x: 88.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 G A 17: 56,159,288 (GRCm39) V658I probably benign Het
Ccdc40 T C 11: 119,122,944 (GRCm39) Y249H possibly damaging Het
D6Ertd527e C G 6: 87,088,506 (GRCm39) T223S unknown Homo
Gbp4 G A 5: 105,268,972 (GRCm39) R394C possibly damaging Het
Gpr183 C A 14: 122,191,888 (GRCm39) C211F probably damaging Homo
Lcp1 A T 14: 75,464,446 (GRCm39) I556F possibly damaging Het
Letm1 G A 5: 33,904,788 (GRCm39) P513S probably benign Het
Letm1 G A 5: 33,904,790 (GRCm39) P512L probably benign Het
Msh3 A G 13: 92,483,294 (GRCm39) V283A possibly damaging Het
Nfkb2 G T 19: 46,296,006 (GRCm39) E170D probably benign Het
Npr3 C A 15: 11,848,649 (GRCm39) M439I probably benign Het
Or5m9 A T 2: 85,877,399 (GRCm39) H191L probably benign Het
Pax5 G A 4: 44,691,886 (GRCm39) A120V probably damaging Het
Plcb1 A G 2: 135,179,419 (GRCm39) Y609C probably damaging Het
Plxna1 G A 6: 89,334,318 (GRCm39) H104Y probably benign Homo
Rnf213 A T 11: 119,305,295 (GRCm39) I509F probably damaging Het
Ryr2 T C 13: 11,884,042 (GRCm39) S213G probably damaging Homo
Spint1 A G 2: 119,076,096 (GRCm39) T231A probably damaging Het
Tbcel C A 9: 42,355,796 (GRCm39) C139F probably benign Het
Thbs2 A C 17: 14,900,235 (GRCm39) S573A probably benign Het
Tmem43 C A 6: 91,459,300 (GRCm39) P257Q probably benign Homo
Tmprss13 A G 9: 45,248,430 (GRCm39) probably null Het
Tnc C T 4: 63,936,249 (GRCm39) G229D probably damaging Homo
Ugt1a10 TTCATCA TTCA 1: 88,143,880 (GRCm39) probably benign Het
Vmn1r196 T A 13: 22,478,006 (GRCm39) V215D probably damaging Homo
Vmn1r22 G T 6: 57,877,317 (GRCm39) T220K probably benign Homo
Vmn2r116 G A 17: 23,606,253 (GRCm39) M388I possibly damaging Het
Zap70 A G 1: 36,809,892 (GRCm39) M1V probably null Homo
Zfp282 A G 6: 47,874,815 (GRCm39) D340G probably damaging Homo
Zfp282 T A 6: 47,881,987 (GRCm39) I558N possibly damaging Homo
Other mutations in Or5m10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01536:Or5m10 APN 2 85,717,944 (GRCm39) missense probably damaging 1.00
IGL01622:Or5m10 APN 2 85,717,306 (GRCm39) missense probably benign 0.01
IGL01623:Or5m10 APN 2 85,717,306 (GRCm39) missense probably benign 0.01
IGL01977:Or5m10 APN 2 85,717,711 (GRCm39) missense probably damaging 1.00
IGL02057:Or5m10 APN 2 85,717,275 (GRCm39) missense probably benign 0.00
IGL02555:Or5m10 APN 2 85,717,742 (GRCm39) missense probably benign 0.34
IGL03133:Or5m10 APN 2 85,717,478 (GRCm39) missense probably damaging 1.00
IGL03180:Or5m10 APN 2 85,717,740 (GRCm39) missense probably benign 0.00
R0415:Or5m10 UTSW 2 85,717,782 (GRCm39) missense possibly damaging 0.94
R1476:Or5m10 UTSW 2 85,717,592 (GRCm39) nonsense probably null
R1544:Or5m10 UTSW 2 85,717,615 (GRCm39) missense probably damaging 1.00
R2058:Or5m10 UTSW 2 85,717,296 (GRCm39) missense possibly damaging 0.48
R4096:Or5m10 UTSW 2 85,717,767 (GRCm39) missense probably damaging 0.98
R5055:Or5m10 UTSW 2 85,717,585 (GRCm39) missense probably benign 0.12
R5703:Or5m10 UTSW 2 85,717,783 (GRCm39) missense probably benign 0.06
R6297:Or5m10 UTSW 2 85,717,159 (GRCm39) missense probably benign 0.35
R7041:Or5m10 UTSW 2 85,717,965 (GRCm39) missense probably benign 0.01
R7070:Or5m10 UTSW 2 85,718,034 (GRCm39) missense probably benign 0.13
R7563:Or5m10 UTSW 2 85,717,482 (GRCm39) missense probably damaging 0.98
R7777:Or5m10 UTSW 2 85,717,951 (GRCm39) missense possibly damaging 0.83
R7913:Or5m10 UTSW 2 85,718,074 (GRCm39) missense probably damaging 0.96
R9060:Or5m10 UTSW 2 85,717,920 (GRCm39) missense probably benign 0.06
R9789:Or5m10 UTSW 2 85,717,338 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATGGGCTGTCTCAGACTCTG -3'
(R):5'- GATCAAGGGGTTCAACATTGG -3'

Sequencing Primer
(F):5'- GGCTGTCTCAGACTCTGCTCAC -3'
(R):5'- TGCAATTACTTTTGACTCTTCTACAG -3'
Posted On 2016-05-10