Incidental Mutation 'S24628:Plcb1'
ID 385648
Institutional Source Beutler Lab
Gene Symbol Plcb1
Ensembl Gene ENSMUSG00000051177
Gene Name phospholipase C, beta 1
Synonyms 3110043I21Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.226) question?
Stock # S24628 () of strain waterfowl
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 134786067-135475258 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 135337499 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 609 (Y609C)
Ref Sequence ENSEMBL: ENSMUSP00000118756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070724] [ENSMUST00000110116] [ENSMUST00000131552]
AlphaFold Q9Z1B3
Predicted Effect probably damaging
Transcript: ENSMUST00000070724
AA Change: Y609C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064844
Gene: ENSMUSG00000051177
AA Change: Y609C

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 2.2e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1.3e-7 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 997 1155 1.9e-64 PFAM
low complexity region 1157 1168 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110116
AA Change: Y609C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105743
Gene: ENSMUSG00000051177
AA Change: Y609C

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 4.1e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1.1e-9 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 1003 1176 2.9e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000131552
AA Change: Y609C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118756
Gene: ENSMUSG00000051177
AA Change: Y609C

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 3.9e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1e-9 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 1003 1148 8e-51 PFAM
low complexity region 1157 1168 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153402
Meta Mutation Damage Score 0.9571 question?
Coding Region Coverage
  • 1x: 98.1%
  • 3x: 97.0%
  • 10x: 94.3%
  • 20x: 88.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals. This gene is activated by two G-protein alpha subunits, alpha-q and alpha-11. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit spontaneous seizures and high mortality around 3 weeks of age. Mutant males show exhibit sperm with a reduced acrosome reaction rate and fertilizing capacity in vitro and decreased fertility in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 G A 17: 55,852,288 (GRCm38) V658I probably benign Het
Ccdc40 T C 11: 119,232,118 (GRCm38) Y249H possibly damaging Het
D6Ertd527e C G 6: 87,111,524 (GRCm38) T223S unknown Homo
Gbp4 G A 5: 105,121,106 (GRCm38) R394C possibly damaging Het
Gpr183 C A 14: 121,954,476 (GRCm38) C211F probably damaging Homo
Lcp1 A T 14: 75,227,006 (GRCm38) I556F possibly damaging Het
Letm1 G A 5: 33,747,446 (GRCm38) P512L probably benign Het
Letm1 G A 5: 33,747,444 (GRCm38) P513S probably benign Het
Msh3 A G 13: 92,346,786 (GRCm38) V283A possibly damaging Het
Nfkb2 G T 19: 46,307,567 (GRCm38) E170D probably benign Het
Npr3 C A 15: 11,848,563 (GRCm38) M439I probably benign Het
Olfr1023 A T 2: 85,887,438 (GRCm38) I213F possibly damaging Het
Olfr1034 A T 2: 86,047,055 (GRCm38) H191L probably benign Het
Pax5 G A 4: 44,691,886 (GRCm38) A120V probably damaging Het
Plxna1 G A 6: 89,357,336 (GRCm38) H104Y probably benign Homo
Rnf213 A T 11: 119,414,469 (GRCm38) I509F probably damaging Het
Ryr2 T C 13: 11,869,156 (GRCm38) S213G probably damaging Homo
Spint1 A G 2: 119,245,615 (GRCm38) T231A probably damaging Het
Tbcel C A 9: 42,444,500 (GRCm38) C139F probably benign Het
Thbs2 A C 17: 14,679,973 (GRCm38) S573A probably benign Het
Tmem43 C A 6: 91,482,318 (GRCm38) P257Q probably benign Homo
Tmprss13 A G 9: 45,337,132 (GRCm38) probably null Het
Tnc C T 4: 64,018,012 (GRCm38) G229D probably damaging Homo
Ugt1a10 TTCATCA TTCA 1: 88,216,158 (GRCm38) probably benign Het
Vmn1r196 T A 13: 22,293,836 (GRCm38) V215D probably damaging Homo
Vmn1r22 G T 6: 57,900,332 (GRCm38) T220K probably benign Homo
Vmn2r116 G A 17: 23,387,279 (GRCm38) M388I possibly damaging Het
Zap70 A G 1: 36,770,811 (GRCm38) M1V probably null Homo
Zfp282 A G 6: 47,897,881 (GRCm38) D340G probably damaging Homo
Zfp282 T A 6: 47,905,053 (GRCm38) I558N possibly damaging Homo
Other mutations in Plcb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Plcb1 APN 2 135,251,756 (GRCm38) missense possibly damaging 0.66
IGL01152:Plcb1 APN 2 134,813,659 (GRCm38) missense probably damaging 1.00
IGL01945:Plcb1 APN 2 135,220,791 (GRCm38) missense probably benign 0.03
IGL01999:Plcb1 APN 2 135,346,318 (GRCm38) missense probably damaging 1.00
IGL02109:Plcb1 APN 2 134,786,559 (GRCm38) missense probably damaging 1.00
IGL02153:Plcb1 APN 2 135,387,853 (GRCm38) missense probably benign 0.08
IGL02207:Plcb1 APN 2 135,387,171 (GRCm38) missense probably damaging 1.00
IGL02566:Plcb1 APN 2 135,472,263 (GRCm38) missense probably benign 0.17
IGL02590:Plcb1 APN 2 135,294,864 (GRCm38) missense probably benign 0.08
IGL02640:Plcb1 APN 2 135,220,859 (GRCm38) splice site probably benign
IGL02926:Plcb1 APN 2 135,364,762 (GRCm38) splice site probably benign
IGL03071:Plcb1 APN 2 135,387,802 (GRCm38) missense probably damaging 1.00
IGL03236:Plcb1 APN 2 135,346,306 (GRCm38) missense probably damaging 1.00
IGL03252:Plcb1 APN 2 135,370,428 (GRCm38) missense probably benign
IGL03387:Plcb1 APN 2 134,813,686 (GRCm38) splice site probably benign
BB001:Plcb1 UTSW 2 135,359,693 (GRCm38) missense probably benign 0.00
BB011:Plcb1 UTSW 2 135,359,693 (GRCm38) missense probably benign 0.00
R0024:Plcb1 UTSW 2 135,362,425 (GRCm38) missense probably benign 0.06
R0024:Plcb1 UTSW 2 135,362,425 (GRCm38) missense probably benign 0.06
R0053:Plcb1 UTSW 2 135,294,915 (GRCm38) missense probably benign 0.33
R0053:Plcb1 UTSW 2 135,294,915 (GRCm38) missense probably benign 0.33
R0308:Plcb1 UTSW 2 134,813,614 (GRCm38) missense probably benign 0.01
R0415:Plcb1 UTSW 2 135,337,499 (GRCm38) missense probably damaging 1.00
R0624:Plcb1 UTSW 2 135,294,911 (GRCm38) missense possibly damaging 0.81
R0898:Plcb1 UTSW 2 135,387,143 (GRCm38) missense possibly damaging 0.73
R1071:Plcb1 UTSW 2 135,325,657 (GRCm38) missense possibly damaging 0.64
R1615:Plcb1 UTSW 2 135,362,444 (GRCm38) splice site probably benign
R1617:Plcb1 UTSW 2 135,337,441 (GRCm38) missense probably damaging 1.00
R1785:Plcb1 UTSW 2 135,325,667 (GRCm38) nonsense probably null
R1866:Plcb1 UTSW 2 135,344,173 (GRCm38) missense probably benign 0.01
R1869:Plcb1 UTSW 2 135,311,014 (GRCm38) missense probably benign 0.02
R1902:Plcb1 UTSW 2 134,813,613 (GRCm38) missense possibly damaging 0.93
R1938:Plcb1 UTSW 2 135,386,302 (GRCm38) missense probably damaging 1.00
R2016:Plcb1 UTSW 2 135,362,420 (GRCm38) missense possibly damaging 0.94
R2017:Plcb1 UTSW 2 135,362,420 (GRCm38) missense possibly damaging 0.94
R2131:Plcb1 UTSW 2 135,325,667 (GRCm38) nonsense probably null
R2132:Plcb1 UTSW 2 135,325,667 (GRCm38) nonsense probably null
R2133:Plcb1 UTSW 2 135,325,667 (GRCm38) nonsense probably null
R2164:Plcb1 UTSW 2 135,346,330 (GRCm38) missense possibly damaging 0.87
R2419:Plcb1 UTSW 2 135,262,100 (GRCm38) splice site probably benign
R2429:Plcb1 UTSW 2 135,337,442 (GRCm38) missense probably damaging 0.99
R2508:Plcb1 UTSW 2 135,260,508 (GRCm38) missense probably benign 0.27
R3161:Plcb1 UTSW 2 135,335,482 (GRCm38) missense probably benign 0.03
R3870:Plcb1 UTSW 2 135,325,671 (GRCm38) missense probably damaging 0.99
R4191:Plcb1 UTSW 2 135,345,090 (GRCm38) missense probably damaging 1.00
R4239:Plcb1 UTSW 2 135,344,158 (GRCm38) missense probably damaging 0.99
R4552:Plcb1 UTSW 2 135,335,493 (GRCm38) missense probably benign 0.44
R4553:Plcb1 UTSW 2 135,335,493 (GRCm38) missense probably benign 0.44
R4720:Plcb1 UTSW 2 135,251,747 (GRCm38) missense possibly damaging 0.70
R4946:Plcb1 UTSW 2 135,345,095 (GRCm38) missense probably benign 0.01
R5012:Plcb1 UTSW 2 135,333,400 (GRCm38) missense probably null 0.97
R5151:Plcb1 UTSW 2 135,262,245 (GRCm38) missense probably benign 0.28
R5320:Plcb1 UTSW 2 135,252,776 (GRCm38) missense possibly damaging 0.56
R5415:Plcb1 UTSW 2 135,347,402 (GRCm38) missense possibly damaging 0.67
R5523:Plcb1 UTSW 2 135,260,566 (GRCm38) missense probably benign 0.08
R5568:Plcb1 UTSW 2 135,370,593 (GRCm38) missense probably damaging 1.00
R5688:Plcb1 UTSW 2 135,335,480 (GRCm38) missense probably benign 0.06
R5809:Plcb1 UTSW 2 135,262,244 (GRCm38) missense possibly damaging 0.83
R6237:Plcb1 UTSW 2 135,370,566 (GRCm38) missense possibly damaging 0.94
R6315:Plcb1 UTSW 2 135,346,341 (GRCm38) missense probably benign 0.00
R6478:Plcb1 UTSW 2 135,335,451 (GRCm38) missense probably damaging 1.00
R6531:Plcb1 UTSW 2 135,325,802 (GRCm38) critical splice donor site probably null
R6683:Plcb1 UTSW 2 134,786,593 (GRCm38) missense probably benign 0.32
R6760:Plcb1 UTSW 2 135,472,060 (GRCm38) missense possibly damaging 0.50
R6947:Plcb1 UTSW 2 135,386,155 (GRCm38) missense probably benign 0.08
R6976:Plcb1 UTSW 2 135,262,239 (GRCm38) missense possibly damaging 0.75
R7379:Plcb1 UTSW 2 135,370,510 (GRCm38) missense probably benign 0.45
R7473:Plcb1 UTSW 2 135,344,276 (GRCm38) missense probably damaging 0.98
R7492:Plcb1 UTSW 2 135,251,764 (GRCm38) nonsense probably null
R7498:Plcb1 UTSW 2 135,262,234 (GRCm38) missense probably damaging 0.99
R7498:Plcb1 UTSW 2 135,262,233 (GRCm38) nonsense probably null
R7777:Plcb1 UTSW 2 135,220,757 (GRCm38) missense possibly damaging 0.51
R7924:Plcb1 UTSW 2 135,359,693 (GRCm38) missense probably benign 0.00
R8061:Plcb1 UTSW 2 135,346,396 (GRCm38) missense probably benign
R8099:Plcb1 UTSW 2 135,251,734 (GRCm38) missense possibly damaging 0.68
R8299:Plcb1 UTSW 2 135,335,476 (GRCm38) missense probably damaging 1.00
R8394:Plcb1 UTSW 2 135,317,790 (GRCm38) missense probably damaging 1.00
R8439:Plcb1 UTSW 2 135,250,052 (GRCm38) critical splice donor site probably null
R8549:Plcb1 UTSW 2 135,364,933 (GRCm38) missense probably benign 0.00
R8693:Plcb1 UTSW 2 135,252,776 (GRCm38) missense probably benign 0.00
R8750:Plcb1 UTSW 2 135,335,449 (GRCm38) missense probably damaging 1.00
R8817:Plcb1 UTSW 2 135,333,509 (GRCm38) intron probably benign
R8950:Plcb1 UTSW 2 135,337,519 (GRCm38) missense probably damaging 1.00
R9146:Plcb1 UTSW 2 135,340,695 (GRCm38) missense probably damaging 1.00
R9301:Plcb1 UTSW 2 135,325,690 (GRCm38) missense possibly damaging 0.96
R9311:Plcb1 UTSW 2 135,347,465 (GRCm38) missense probably benign 0.00
R9459:Plcb1 UTSW 2 135,322,638 (GRCm38) missense probably benign 0.03
X0025:Plcb1 UTSW 2 135,345,054 (GRCm38) missense possibly damaging 0.87
Z1088:Plcb1 UTSW 2 135,220,846 (GRCm38) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCCACAGGTTTCCCAGAAGC -3'
(R):5'- TGTCAGTACACATATGACTGTAGG -3'

Sequencing Primer
(F):5'- AGGTTTCCCAGAAGCAATACTG -3'
(R):5'- ACTGTAGGAAAATAGCATGAAATCC -3'
Posted On 2016-05-10