Incidental Mutation 'R0423:Spag6'
Institutional Source Beutler Lab
Gene Symbol Spag6
Ensembl Gene ENSMUSG00000037708
Gene Namesperm associated antigen 6
SynonymsBC061194, Spag6l
MMRRC Submission 038625-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R0423 (G1)
Quality Score143
Status Validated
Chromosomal Location18694032-18750413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18710593 bp
Amino Acid Change Aspartic acid to Glycine at position 61 (D61G)
Ref Sequence ENSEMBL: ENSMUSP00000133383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095132] [ENSMUST00000173763]
Predicted Effect probably benign
Transcript: ENSMUST00000095132
AA Change: D83G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000092751
Gene: ENSMUSG00000037708
AA Change: D83G

ARM 30 70 2.26e-3 SMART
ARM 114 154 1.67e-6 SMART
ARM 156 196 4.28e-4 SMART
ARM 198 238 5.43e-6 SMART
ARM 240 280 4.6e0 SMART
ARM 282 322 3.09e1 SMART
ARM 323 365 3.93e-3 SMART
Blast:ARM 367 409 7e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173763
AA Change: D61G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000133383
Gene: ENSMUSG00000037708
AA Change: D61G

ARM 8 48 2.26e-3 SMART
Blast:ARM 50 90 2e-14 BLAST
ARM 92 132 1.67e-6 SMART
ARM 134 166 5.76e1 SMART
Meta Mutation Damage Score 0.2125 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.9%
Validation Efficiency 99% (84/85)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik T C 2: 28,466,024 probably benign Het
4930432E11Rik A T 7: 29,562,400 noncoding transcript Het
A630001G21Rik A G 1: 85,726,466 I50T probably benign Het
Abhd12 T C 2: 150,838,392 T264A possibly damaging Het
Acsm3 T C 7: 119,777,159 Y370H probably damaging Het
Ank2 G T 3: 126,929,860 Y3789* probably null Het
Anxa4 C T 6: 86,760,737 A1T probably damaging Het
Apba1 T A 19: 23,944,998 V810D probably damaging Het
Bank1 A G 3: 136,284,017 I104T possibly damaging Het
Birc6 T C 17: 74,696,297 Y4721H probably damaging Het
Bmpr2 A G 1: 59,868,510 T921A probably benign Het
Ccdc102a A C 8: 94,905,926 probably benign Het
Ccdc141 C A 2: 77,039,450 D904Y probably damaging Het
Ccdc96 A G 5: 36,485,247 K199R probably benign Het
Cdh10 G A 15: 18,986,879 V399I probably benign Het
Cenpk A G 13: 104,234,225 T85A probably benign Het
Col6a2 A C 10: 76,614,917 V60G possibly damaging Het
Cops7b A G 1: 86,599,031 D119G probably benign Het
Cstf2t A G 19: 31,084,276 E404G possibly damaging Het
Ctnna2 A T 6: 77,653,069 V134E probably damaging Het
Cwh43 A C 5: 73,416,742 M250L probably benign Het
D17Wsu92e A C 17: 27,786,233 Y117D probably damaging Het
Daam2 T A 17: 49,469,421 K813* probably null Het
Dhcr24 G A 4: 106,586,536 probably benign Het
Dnah8 G T 17: 30,701,981 R1182L probably benign Het
Doc2a C T 7: 126,848,658 P25S probably damaging Het
Dst A G 1: 34,278,035 S6823G possibly damaging Het
Espl1 T A 15: 102,303,986 L509* probably null Het
Fbxw19 C T 9: 109,486,066 V143I probably benign Het
Fbxw5 A G 2: 25,504,526 T171A possibly damaging Het
Gfra2 C T 14: 70,896,081 T117M probably damaging Het
Gm454 T A 5: 138,204,141 noncoding transcript Het
Kcnq4 A G 4: 120,717,508 S120P probably damaging Het
Krt84 A T 15: 101,528,720 L336Q probably damaging Het
Lilra6 T A 7: 3,914,775 probably benign Het
Mbnl2 G A 14: 120,325,324 R29H probably damaging Het
Mcm3ap G A 10: 76,502,705 G1389D probably benign Het
Mettl13 A T 1: 162,544,385 I305N probably damaging Het
Muc6 A G 7: 141,652,283 S30P probably benign Het
Myh7 T A 14: 54,979,189 Q1237L probably benign Het
Myo9a T G 9: 59,895,336 D2035E probably damaging Het
Nat10 A G 2: 103,748,227 S211P probably damaging Het
Ntm T C 9: 29,179,099 Y108C probably damaging Het
Olfr292 T C 7: 86,695,226 Y257H possibly damaging Het
Olfr843 A T 9: 19,248,952 L149* probably null Het
Pcdhb16 A G 18: 37,480,369 D794G probably benign Het
Phlpp1 A G 1: 106,339,615 T753A probably benign Het
Pnldc1 T C 17: 12,890,076 Q511R possibly damaging Het
Ppip5k2 A G 1: 97,761,427 S38P possibly damaging Het
Pygb A G 2: 150,823,984 K593E probably benign Het
Rangap1 A T 15: 81,705,463 F564I probably damaging Het
Rictor A T 15: 6,773,900 I498F possibly damaging Het
Rnase12 A T 14: 51,057,156 V22D probably benign Het
Rpl7l1 T A 17: 46,780,398 M93L probably benign Het
Smg1 T C 7: 118,176,880 R1396G possibly damaging Het
Snx19 C A 9: 30,435,837 T692N probably damaging Het
Spen T A 4: 141,479,336 N660I unknown Het
Sptan1 T G 2: 30,028,672 C2246G probably null Het
Svopl A G 6: 38,036,707 probably benign Het
Taf2 A T 15: 55,064,682 N108K probably benign Het
Thbs4 T C 13: 92,756,571 D703G probably damaging Het
Tle6 G T 10: 81,598,623 N47K possibly damaging Het
Usp48 G T 4: 137,616,411 V452L probably benign Het
Ust A T 10: 8,298,148 S198T probably damaging Het
Wnk2 T A 13: 49,095,418 M386L possibly damaging Het
Ywhaq T C 12: 21,391,381 probably benign Het
Zfp11 C T 5: 129,658,238 G53E possibly damaging Het
Zfp316 A G 5: 143,253,238 S1009P probably damaging Het
Zfp963 A G 8: 69,744,506 Y29H probably damaging Het
Zmym4 A G 4: 126,882,319 probably benign Het
Zranb3 A G 1: 128,091,870 I45T probably damaging Het
Other mutations in Spag6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Spag6 APN 2 18734184 missense probably benign 0.31
IGL01352:Spag6 APN 2 18710473 missense possibly damaging 0.77
IGL02795:Spag6 APN 2 18733083 missense probably benign
IGL03406:Spag6 APN 2 18742873 splice site probably benign
R0362:Spag6 UTSW 2 18710491 missense probably damaging 0.99
R1309:Spag6 UTSW 2 18734216 missense probably damaging 1.00
R1386:Spag6 UTSW 2 18734246 missense possibly damaging 0.49
R1568:Spag6 UTSW 2 18733114 missense probably benign
R1716:Spag6 UTSW 2 18745609 splice site probably null
R1771:Spag6 UTSW 2 18734117 missense probably benign 0.22
R1911:Spag6 UTSW 2 18715805 nonsense probably null
R1985:Spag6 UTSW 2 18732119 missense probably benign 0.00
R2029:Spag6 UTSW 2 18734105 unclassified probably benign
R2131:Spag6 UTSW 2 18733097 nonsense probably null
R3705:Spag6 UTSW 2 18710557 missense probably damaging 0.99
R4230:Spag6 UTSW 2 18715638 splice site probably null
R4585:Spag6 UTSW 2 18732147 critical splice donor site probably null
R4586:Spag6 UTSW 2 18732147 critical splice donor site probably null
R4692:Spag6 UTSW 2 18699243 missense probably benign 0.24
R4745:Spag6 UTSW 2 18737296 missense possibly damaging 0.78
R4890:Spag6 UTSW 2 18742777 missense probably benign 0.00
R4914:Spag6 UTSW 2 18745549 missense probably benign 0.00
R4918:Spag6 UTSW 2 18745549 missense probably benign 0.00
R5086:Spag6 UTSW 2 18742877 splice site probably benign
R5264:Spag6 UTSW 2 18745513 missense probably benign 0.00
R5729:Spag6 UTSW 2 18715714 missense probably benign
R5754:Spag6 UTSW 2 18698802 unclassified probably benign
R5781:Spag6 UTSW 2 18731993 missense probably benign
R5954:Spag6 UTSW 2 18710606 missense probably damaging 1.00
R6246:Spag6 UTSW 2 18699095 critical splice donor site probably null
R7607:Spag6 UTSW 2 18731962 missense possibly damaging 0.87
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- agagagagtgagagagagagag -3'
Posted On2013-05-23