Incidental Mutation 'S24628:Tnc'
ID 385650
Institutional Source Beutler Lab
Gene Symbol Tnc
Ensembl Gene ENSMUSG00000028364
Gene Name tenascin C
Synonyms cytotactin, C130033P17Rik, TN-C, hexabrachion, tenascin-C, Hxb, TN
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # S24628 () of strain waterfowl
Quality Score 222
Status Not validated
Chromosome 4
Chromosomal Location 63878022-63965252 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 63936249 bp (GRCm39)
Zygosity Homozygous
Amino Acid Change Glycine to Aspartic acid at position 229 (G229D)
Ref Sequence ENSEMBL: ENSMUSP00000103000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030056] [ENSMUST00000107371] [ENSMUST00000107372] [ENSMUST00000107377]
AlphaFold Q80YX1
Predicted Effect probably damaging
Transcript: ENSMUST00000030056
AA Change: G229D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030056
Gene: ENSMUSG00000028364
AA Change: G229D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
FN3 803 884 7.23e-8 SMART
FN3 893 974 1.71e-9 SMART
FN3 985 1062 2.56e-8 SMART
FN3 1074 1152 8.58e-1 SMART
FN3 1165 1245 2.72e-3 SMART
FN3 1256 1334 5.36e-2 SMART
FN3 1347 1427 4.93e0 SMART
FN3 1438 1517 3.4e-4 SMART
FN3 1528 1606 1.55e-7 SMART
FN3 1617 1694 1.53e-6 SMART
FN3 1705 1782 7.75e-8 SMART
FBG 1797 2007 4.08e-124 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107371
AA Change: G229D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102994
Gene: ENSMUSG00000028364
AA Change: G229D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
Pfam:hEGF 173 185 4e-4 PFAM
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107372
AA Change: G229D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102995
Gene: ENSMUSG00000028364
AA Change: G229D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
FN3 803 884 7.23e-8 SMART
FN3 893 974 1.71e-9 SMART
FN3 985 1062 2.56e-8 SMART
FN3 1074 1152 8.58e-1 SMART
FN3 1165 1245 2.72e-3 SMART
FN3 1256 1334 5.36e-2 SMART
FN3 1347 1427 4.93e0 SMART
FN3 1438 1517 2.75e0 SMART
FN3 1529 1608 3.4e-4 SMART
FN3 1619 1697 1.55e-7 SMART
FN3 1708 1785 1.53e-6 SMART
FN3 1796 1873 7.75e-8 SMART
FBG 1888 2098 4.08e-124 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107377
AA Change: G229D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103000
Gene: ENSMUSG00000028364
AA Change: G229D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
FN3 803 884 7.23e-8 SMART
FN3 893 974 1.71e-9 SMART
FN3 985 1062 2.56e-8 SMART
FN3 1074 1152 8.58e-1 SMART
FN3 1165 1245 2.72e-3 SMART
FN3 1256 1334 5.36e-2 SMART
FN3 1347 1427 4.93e0 SMART
FN3 1438 1517 3.4e-4 SMART
FN3 1528 1606 1.55e-7 SMART
FN3 1617 1694 1.53e-6 SMART
FN3 1705 1782 7.75e-8 SMART
FBG 1797 2007 4.08e-124 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141428
Coding Region Coverage
  • 1x: 98.1%
  • 3x: 97.0%
  • 10x: 94.3%
  • 20x: 88.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix protein with a spatially and temporally restricted tissue distribution. This protein is homohexameric with disulfide-linked subunits, and contains multiple EGF-like and fibronectin type-III domains. It is implicated in guidance of migrating neurons as well as axons during development, synaptic plasticity, and neuronal regeneration. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for several different targeted mutations show variable behavioral and nervous system phenotypes such as abnormal circadian rhythm, anxiety behavior, novelty-induced activity, swimming, impaired synaptic plasticity, long term potentiation and serotonin and dopamine neurotransmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 G A 17: 56,159,288 (GRCm39) V658I probably benign Het
Ccdc40 T C 11: 119,122,944 (GRCm39) Y249H possibly damaging Het
D6Ertd527e C G 6: 87,088,506 (GRCm39) T223S unknown Homo
Gbp4 G A 5: 105,268,972 (GRCm39) R394C possibly damaging Het
Gpr183 C A 14: 122,191,888 (GRCm39) C211F probably damaging Homo
Lcp1 A T 14: 75,464,446 (GRCm39) I556F possibly damaging Het
Letm1 G A 5: 33,904,788 (GRCm39) P513S probably benign Het
Letm1 G A 5: 33,904,790 (GRCm39) P512L probably benign Het
Msh3 A G 13: 92,483,294 (GRCm39) V283A possibly damaging Het
Nfkb2 G T 19: 46,296,006 (GRCm39) E170D probably benign Het
Npr3 C A 15: 11,848,649 (GRCm39) M439I probably benign Het
Or5m10 A T 2: 85,717,782 (GRCm39) I213F possibly damaging Het
Or5m9 A T 2: 85,877,399 (GRCm39) H191L probably benign Het
Pax5 G A 4: 44,691,886 (GRCm39) A120V probably damaging Het
Plcb1 A G 2: 135,179,419 (GRCm39) Y609C probably damaging Het
Plxna1 G A 6: 89,334,318 (GRCm39) H104Y probably benign Homo
Rnf213 A T 11: 119,305,295 (GRCm39) I509F probably damaging Het
Ryr2 T C 13: 11,884,042 (GRCm39) S213G probably damaging Homo
Spint1 A G 2: 119,076,096 (GRCm39) T231A probably damaging Het
Tbcel C A 9: 42,355,796 (GRCm39) C139F probably benign Het
Thbs2 A C 17: 14,900,235 (GRCm39) S573A probably benign Het
Tmem43 C A 6: 91,459,300 (GRCm39) P257Q probably benign Homo
Tmprss13 A G 9: 45,248,430 (GRCm39) probably null Het
Ugt1a10 TTCATCA TTCA 1: 88,143,880 (GRCm39) probably benign Het
Vmn1r196 T A 13: 22,478,006 (GRCm39) V215D probably damaging Homo
Vmn1r22 G T 6: 57,877,317 (GRCm39) T220K probably benign Homo
Vmn2r116 G A 17: 23,606,253 (GRCm39) M388I possibly damaging Het
Zap70 A G 1: 36,809,892 (GRCm39) M1V probably null Homo
Zfp282 A G 6: 47,874,815 (GRCm39) D340G probably damaging Homo
Zfp282 T A 6: 47,881,987 (GRCm39) I558N possibly damaging Homo
Other mutations in Tnc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Tnc APN 4 63,935,061 (GRCm39) splice site probably benign
IGL00531:Tnc APN 4 63,889,390 (GRCm39) splice site probably benign
IGL00674:Tnc APN 4 63,883,844 (GRCm39) missense probably damaging 1.00
IGL01015:Tnc APN 4 63,935,571 (GRCm39) missense probably benign 0.19
IGL01090:Tnc APN 4 63,918,317 (GRCm39) missense probably damaging 1.00
IGL01310:Tnc APN 4 63,931,314 (GRCm39) missense probably benign 0.03
IGL01331:Tnc APN 4 63,901,112 (GRCm39) missense probably damaging 0.99
IGL01393:Tnc APN 4 63,932,291 (GRCm39) splice site probably benign
IGL01411:Tnc APN 4 63,918,959 (GRCm39) missense probably damaging 0.96
IGL01472:Tnc APN 4 63,924,656 (GRCm39) missense probably benign 0.00
IGL01552:Tnc APN 4 63,888,645 (GRCm39) missense probably damaging 1.00
IGL01661:Tnc APN 4 63,888,544 (GRCm39) splice site probably benign
IGL01669:Tnc APN 4 63,918,938 (GRCm39) missense probably damaging 1.00
IGL01912:Tnc APN 4 63,926,977 (GRCm39) missense probably damaging 1.00
IGL02028:Tnc APN 4 63,884,909 (GRCm39) splice site probably benign
IGL02100:Tnc APN 4 63,918,398 (GRCm39) missense possibly damaging 0.84
IGL02549:Tnc APN 4 63,933,309 (GRCm39) missense probably damaging 1.00
IGL02642:Tnc APN 4 63,883,816 (GRCm39) splice site probably benign
IGL02712:Tnc APN 4 63,893,493 (GRCm39) missense probably damaging 1.00
IGL02876:Tnc APN 4 63,933,338 (GRCm39) missense possibly damaging 0.56
IGL02886:Tnc APN 4 63,918,344 (GRCm39) missense probably damaging 0.96
IGL02972:Tnc APN 4 63,894,715 (GRCm39) missense probably benign 0.11
IGL03073:Tnc APN 4 63,889,461 (GRCm39) missense possibly damaging 0.58
IGL03116:Tnc APN 4 63,932,270 (GRCm39) missense probably damaging 1.00
IGL03181:Tnc APN 4 63,885,543 (GRCm39) missense possibly damaging 0.95
IGL03358:Tnc APN 4 63,935,852 (GRCm39) nonsense probably null
tancredo UTSW 4 63,911,534 (GRCm39) nonsense probably null
BB009:Tnc UTSW 4 63,926,857 (GRCm39) missense probably benign
BB019:Tnc UTSW 4 63,926,857 (GRCm39) missense probably benign
P0020:Tnc UTSW 4 63,927,094 (GRCm39) missense possibly damaging 0.63
PIT4377001:Tnc UTSW 4 63,935,973 (GRCm39) missense probably damaging 1.00
PIT4403001:Tnc UTSW 4 63,882,904 (GRCm39) missense probably damaging 1.00
PIT4468001:Tnc UTSW 4 63,882,904 (GRCm39) missense probably damaging 1.00
R0243:Tnc UTSW 4 63,888,657 (GRCm39) missense probably damaging 0.98
R0362:Tnc UTSW 4 63,935,679 (GRCm39) missense probably damaging 1.00
R0410:Tnc UTSW 4 63,925,931 (GRCm39) missense probably benign 0.00
R0420:Tnc UTSW 4 63,918,396 (GRCm39) missense probably benign 0.00
R0540:Tnc UTSW 4 63,938,692 (GRCm39) missense probably damaging 1.00
R0650:Tnc UTSW 4 63,926,971 (GRCm39) missense probably benign 0.00
R1019:Tnc UTSW 4 63,880,319 (GRCm39) missense probably damaging 1.00
R1102:Tnc UTSW 4 63,938,705 (GRCm39) missense probably benign 0.05
R1126:Tnc UTSW 4 63,936,357 (GRCm39) missense probably damaging 0.99
R1141:Tnc UTSW 4 63,932,231 (GRCm39) missense probably damaging 1.00
R1142:Tnc UTSW 4 63,932,231 (GRCm39) missense probably damaging 1.00
R1307:Tnc UTSW 4 63,927,096 (GRCm39) missense probably damaging 0.98
R1322:Tnc UTSW 4 63,932,231 (GRCm39) missense probably damaging 1.00
R1414:Tnc UTSW 4 63,883,932 (GRCm39) splice site probably benign
R1470:Tnc UTSW 4 63,884,811 (GRCm39) missense probably damaging 1.00
R1470:Tnc UTSW 4 63,884,811 (GRCm39) missense probably damaging 1.00
R1499:Tnc UTSW 4 63,882,991 (GRCm39) missense probably benign 0.15
R1506:Tnc UTSW 4 63,925,921 (GRCm39) missense possibly damaging 0.90
R1597:Tnc UTSW 4 63,924,621 (GRCm39) missense probably benign
R1750:Tnc UTSW 4 63,890,972 (GRCm39) missense probably damaging 1.00
R1765:Tnc UTSW 4 63,932,231 (GRCm39) missense probably damaging 1.00
R1783:Tnc UTSW 4 63,936,333 (GRCm39) missense probably damaging 0.98
R1808:Tnc UTSW 4 63,918,168 (GRCm39) missense probably damaging 1.00
R1903:Tnc UTSW 4 63,918,299 (GRCm39) missense probably benign 0.00
R1932:Tnc UTSW 4 63,911,262 (GRCm39) critical splice donor site probably null
R1941:Tnc UTSW 4 63,933,201 (GRCm39) missense probably damaging 1.00
R1983:Tnc UTSW 4 63,902,867 (GRCm39) missense possibly damaging 0.95
R2024:Tnc UTSW 4 63,882,858 (GRCm39) missense probably damaging 1.00
R2075:Tnc UTSW 4 63,913,903 (GRCm39) missense possibly damaging 0.94
R2327:Tnc UTSW 4 63,893,475 (GRCm39) missense possibly damaging 0.78
R2444:Tnc UTSW 4 63,933,200 (GRCm39) missense probably damaging 1.00
R2982:Tnc UTSW 4 63,938,756 (GRCm39) missense possibly damaging 0.81
R3874:Tnc UTSW 4 63,926,947 (GRCm39) missense probably damaging 1.00
R4110:Tnc UTSW 4 63,933,188 (GRCm39) missense probably damaging 1.00
R4360:Tnc UTSW 4 63,935,161 (GRCm39) missense probably benign 0.35
R4371:Tnc UTSW 4 63,888,588 (GRCm39) missense probably damaging 1.00
R4434:Tnc UTSW 4 63,926,066 (GRCm39) missense possibly damaging 0.91
R4438:Tnc UTSW 4 63,926,066 (GRCm39) missense possibly damaging 0.91
R4570:Tnc UTSW 4 63,913,909 (GRCm39) missense probably damaging 0.99
R4595:Tnc UTSW 4 63,913,982 (GRCm39) missense probably damaging 1.00
R4749:Tnc UTSW 4 63,913,876 (GRCm39) missense possibly damaging 0.56
R4756:Tnc UTSW 4 63,885,580 (GRCm39) missense probably damaging 0.99
R4824:Tnc UTSW 4 63,935,857 (GRCm39) nonsense probably null
R4957:Tnc UTSW 4 63,894,793 (GRCm39) missense probably damaging 1.00
R4977:Tnc UTSW 4 63,924,485 (GRCm39) missense possibly damaging 0.82
R5001:Tnc UTSW 4 63,918,299 (GRCm39) missense probably benign 0.16
R5001:Tnc UTSW 4 63,902,726 (GRCm39) missense probably damaging 1.00
R5015:Tnc UTSW 4 63,924,739 (GRCm39) missense probably damaging 1.00
R5049:Tnc UTSW 4 63,936,223 (GRCm39) missense probably damaging 1.00
R5066:Tnc UTSW 4 63,893,466 (GRCm39) missense probably damaging 0.96
R5073:Tnc UTSW 4 63,938,648 (GRCm39) missense probably damaging 1.00
R5116:Tnc UTSW 4 63,885,452 (GRCm39) critical splice donor site probably null
R5195:Tnc UTSW 4 63,885,489 (GRCm39) missense probably damaging 1.00
R5200:Tnc UTSW 4 63,889,515 (GRCm39) missense probably damaging 1.00
R5221:Tnc UTSW 4 63,911,534 (GRCm39) nonsense probably null
R5237:Tnc UTSW 4 63,880,333 (GRCm39) missense probably damaging 1.00
R5265:Tnc UTSW 4 63,911,443 (GRCm39) missense probably benign 0.00
R5275:Tnc UTSW 4 63,882,967 (GRCm39) nonsense probably null
R5346:Tnc UTSW 4 63,926,892 (GRCm39) missense probably benign
R5409:Tnc UTSW 4 63,925,654 (GRCm39) missense probably damaging 1.00
R5409:Tnc UTSW 4 63,884,773 (GRCm39) missense probably damaging 1.00
R5469:Tnc UTSW 4 63,932,162 (GRCm39) splice site probably null
R5518:Tnc UTSW 4 63,935,916 (GRCm39) missense probably damaging 1.00
R5560:Tnc UTSW 4 63,926,946 (GRCm39) missense probably damaging 1.00
R5588:Tnc UTSW 4 63,924,659 (GRCm39) missense possibly damaging 0.57
R5686:Tnc UTSW 4 63,925,967 (GRCm39) splice site probably null
R5686:Tnc UTSW 4 63,927,032 (GRCm39) missense possibly damaging 0.78
R5837:Tnc UTSW 4 63,931,451 (GRCm39) missense probably damaging 1.00
R5976:Tnc UTSW 4 63,936,403 (GRCm39) missense probably benign 0.17
R6156:Tnc UTSW 4 63,888,589 (GRCm39) missense probably damaging 1.00
R6182:Tnc UTSW 4 63,927,033 (GRCm39) missense probably damaging 0.99
R6360:Tnc UTSW 4 63,918,970 (GRCm39) missense probably damaging 1.00
R6416:Tnc UTSW 4 63,926,053 (GRCm39) missense probably benign 0.05
R6778:Tnc UTSW 4 63,913,835 (GRCm39) missense probably benign 0.12
R6798:Tnc UTSW 4 63,883,841 (GRCm39) missense probably benign 0.02
R6799:Tnc UTSW 4 63,883,841 (GRCm39) missense probably benign 0.02
R6943:Tnc UTSW 4 63,900,982 (GRCm39) missense probably damaging 0.97
R7027:Tnc UTSW 4 63,902,826 (GRCm39) missense probably benign 0.02
R7183:Tnc UTSW 4 63,931,365 (GRCm39) missense probably damaging 1.00
R7204:Tnc UTSW 4 63,889,392 (GRCm39) splice site probably null
R7317:Tnc UTSW 4 63,890,959 (GRCm39) missense probably damaging 0.99
R7323:Tnc UTSW 4 63,889,469 (GRCm39) missense probably damaging 0.96
R7327:Tnc UTSW 4 63,882,999 (GRCm39) splice site probably null
R7382:Tnc UTSW 4 63,932,280 (GRCm39) nonsense probably null
R7399:Tnc UTSW 4 63,938,894 (GRCm39) start gained probably benign
R7479:Tnc UTSW 4 63,935,865 (GRCm39) missense possibly damaging 0.95
R7585:Tnc UTSW 4 63,938,648 (GRCm39) missense probably damaging 1.00
R7932:Tnc UTSW 4 63,926,857 (GRCm39) missense probably benign
R7947:Tnc UTSW 4 63,935,580 (GRCm39) missense probably damaging 1.00
R7974:Tnc UTSW 4 63,918,961 (GRCm39) missense possibly damaging 0.84
R7991:Tnc UTSW 4 63,926,983 (GRCm39) missense probably benign 0.42
R8004:Tnc UTSW 4 63,902,894 (GRCm39) missense probably benign 0.04
R8080:Tnc UTSW 4 63,894,706 (GRCm39) missense possibly damaging 0.52
R8109:Tnc UTSW 4 63,927,000 (GRCm39) missense probably benign 0.11
R8145:Tnc UTSW 4 63,935,716 (GRCm39) missense probably benign
R8340:Tnc UTSW 4 63,926,036 (GRCm39) missense probably damaging 1.00
R8360:Tnc UTSW 4 63,885,511 (GRCm39) missense probably benign 0.00
R8671:Tnc UTSW 4 63,935,683 (GRCm39) missense probably damaging 1.00
R8691:Tnc UTSW 4 63,880,313 (GRCm39) missense probably damaging 1.00
R8759:Tnc UTSW 4 63,924,501 (GRCm39) missense possibly damaging 0.86
R8864:Tnc UTSW 4 63,911,296 (GRCm39) missense probably damaging 0.98
R8927:Tnc UTSW 4 63,925,595 (GRCm39) missense probably damaging 1.00
R8928:Tnc UTSW 4 63,925,595 (GRCm39) missense probably damaging 1.00
R8949:Tnc UTSW 4 63,927,087 (GRCm39) missense probably damaging 1.00
R8956:Tnc UTSW 4 63,918,970 (GRCm39) missense probably damaging 1.00
R9016:Tnc UTSW 4 63,935,331 (GRCm39) missense probably benign 0.23
R9049:Tnc UTSW 4 63,918,247 (GRCm39) missense possibly damaging 0.83
R9097:Tnc UTSW 4 63,888,622 (GRCm39) missense possibly damaging 0.62
R9114:Tnc UTSW 4 63,890,973 (GRCm39) missense probably benign 0.03
R9151:Tnc UTSW 4 63,938,686 (GRCm39) missense possibly damaging 0.46
R9488:Tnc UTSW 4 63,913,942 (GRCm39) missense probably damaging 0.99
R9537:Tnc UTSW 4 63,884,821 (GRCm39) missense probably damaging 0.99
R9666:Tnc UTSW 4 63,926,045 (GRCm39) missense probably damaging 1.00
R9700:Tnc UTSW 4 63,933,186 (GRCm39) missense probably damaging 0.99
R9703:Tnc UTSW 4 63,889,412 (GRCm39) missense probably benign 0.00
R9771:Tnc UTSW 4 63,925,600 (GRCm39) missense probably damaging 1.00
Z1177:Tnc UTSW 4 63,925,663 (GRCm39) nonsense probably null
Z1177:Tnc UTSW 4 63,878,781 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ATTGTAGCAGTTGTTGAGGCAAAG -3'
(R):5'- TCAATGCAGGTCGTCTGGAC -3'

Sequencing Primer
(F):5'- AAAGGGGCTCGTTGCAGTC -3'
(R):5'- ACGGGGCAACTTCAGTG -3'
Posted On 2016-05-10