Incidental Mutation 'S24628:Plxna1'
ID 385658
Institutional Source Beutler Lab
Gene Symbol Plxna1
Ensembl Gene ENSMUSG00000030084
Gene Name plexin A1
Synonyms NOV, PlexA1, Plxn1, 2600013D04Rik
Accession Numbers
Essential gene? Probably essential (E-score: 0.888) question?
Stock # S24628 () of strain waterfowl
Quality Score 222
Status Not validated
Chromosome 6
Chromosomal Location 89293295-89339595 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 89334318 bp (GRCm39)
Zygosity Homozygous
Amino Acid Change Histidine to Tyrosine at position 104 (H104Y)
Ref Sequence ENSEMBL: ENSMUSP00000063066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049845] [ENSMUST00000163139]
AlphaFold P70206
PDB Structure The Plexin A1 intracellular region in complex with Rac1 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000049845
AA Change: H104Y

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000063066
Gene: ENSMUSG00000030084
AA Change: H104Y

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Sema 49 494 7.43e-126 SMART
PSI 512 562 6.4e-11 SMART
PSI 658 705 9.78e-7 SMART
low complexity region 759 772 N/A INTRINSIC
PSI 806 860 7.24e-10 SMART
IPT 861 957 3.2e-26 SMART
IPT 958 1043 1.59e-21 SMART
IPT 1045 1145 6.86e-26 SMART
IPT 1147 1242 1.64e-5 SMART
transmembrane domain 1243 1265 N/A INTRINSIC
Pfam:Plexin_cytopl 1316 1864 8.8e-263 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163139
AA Change: H104Y

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000131840
Gene: ENSMUSG00000030084
AA Change: H104Y

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Sema 49 494 7.43e-126 SMART
PSI 512 562 6.4e-11 SMART
PSI 658 705 9.78e-7 SMART
low complexity region 759 772 N/A INTRINSIC
PSI 806 860 7.24e-10 SMART
IPT 861 957 3.2e-26 SMART
IPT 958 1043 1.59e-21 SMART
IPT 1045 1145 6.86e-26 SMART
IPT 1147 1242 1.64e-5 SMART
transmembrane domain 1243 1265 N/A INTRINSIC
Pfam:Plexin_cytopl 1315 1864 2.5e-264 PFAM
Meta Mutation Damage Score 0.1593 question?
Coding Region Coverage
  • 1x: 98.1%
  • 3x: 97.0%
  • 10x: 94.3%
  • 20x: 88.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit bone cellularity abnormalities, altered dendritic cell physiology, abnormal proprioceptive and oligodendrocyte morphology, and increased lymphatic branching complexity and LEC numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 G A 17: 56,159,288 (GRCm39) V658I probably benign Het
Ccdc40 T C 11: 119,122,944 (GRCm39) Y249H possibly damaging Het
D6Ertd527e C G 6: 87,088,506 (GRCm39) T223S unknown Homo
Gbp4 G A 5: 105,268,972 (GRCm39) R394C possibly damaging Het
Gpr183 C A 14: 122,191,888 (GRCm39) C211F probably damaging Homo
Lcp1 A T 14: 75,464,446 (GRCm39) I556F possibly damaging Het
Letm1 G A 5: 33,904,788 (GRCm39) P513S probably benign Het
Letm1 G A 5: 33,904,790 (GRCm39) P512L probably benign Het
Msh3 A G 13: 92,483,294 (GRCm39) V283A possibly damaging Het
Nfkb2 G T 19: 46,296,006 (GRCm39) E170D probably benign Het
Npr3 C A 15: 11,848,649 (GRCm39) M439I probably benign Het
Or5m10 A T 2: 85,717,782 (GRCm39) I213F possibly damaging Het
Or5m9 A T 2: 85,877,399 (GRCm39) H191L probably benign Het
Pax5 G A 4: 44,691,886 (GRCm39) A120V probably damaging Het
Plcb1 A G 2: 135,179,419 (GRCm39) Y609C probably damaging Het
Rnf213 A T 11: 119,305,295 (GRCm39) I509F probably damaging Het
Ryr2 T C 13: 11,884,042 (GRCm39) S213G probably damaging Homo
Spint1 A G 2: 119,076,096 (GRCm39) T231A probably damaging Het
Tbcel C A 9: 42,355,796 (GRCm39) C139F probably benign Het
Thbs2 A C 17: 14,900,235 (GRCm39) S573A probably benign Het
Tmem43 C A 6: 91,459,300 (GRCm39) P257Q probably benign Homo
Tmprss13 A G 9: 45,248,430 (GRCm39) probably null Het
Tnc C T 4: 63,936,249 (GRCm39) G229D probably damaging Homo
Ugt1a10 TTCATCA TTCA 1: 88,143,880 (GRCm39) probably benign Het
Vmn1r196 T A 13: 22,478,006 (GRCm39) V215D probably damaging Homo
Vmn1r22 G T 6: 57,877,317 (GRCm39) T220K probably benign Homo
Vmn2r116 G A 17: 23,606,253 (GRCm39) M388I possibly damaging Het
Zap70 A G 1: 36,809,892 (GRCm39) M1V probably null Homo
Zfp282 A G 6: 47,874,815 (GRCm39) D340G probably damaging Homo
Zfp282 T A 6: 47,881,987 (GRCm39) I558N possibly damaging Homo
Other mutations in Plxna1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Plxna1 APN 6 89,297,980 (GRCm39) missense probably damaging 1.00
IGL01358:Plxna1 APN 6 89,299,732 (GRCm39) missense probably damaging 1.00
IGL01475:Plxna1 APN 6 89,331,870 (GRCm39) missense possibly damaging 0.92
IGL01480:Plxna1 APN 6 89,321,078 (GRCm39) missense possibly damaging 0.70
IGL01585:Plxna1 APN 6 89,306,538 (GRCm39) critical splice donor site probably null
IGL01804:Plxna1 APN 6 89,306,628 (GRCm39) missense probably damaging 1.00
IGL01909:Plxna1 APN 6 89,309,066 (GRCm39) critical splice donor site probably null
IGL01989:Plxna1 APN 6 89,306,396 (GRCm39) nonsense probably null
IGL02015:Plxna1 APN 6 89,319,433 (GRCm39) missense probably damaging 1.00
IGL02023:Plxna1 APN 6 89,334,314 (GRCm39) missense possibly damaging 0.88
IGL02668:Plxna1 APN 6 89,334,251 (GRCm39) nonsense probably null
IGL02703:Plxna1 APN 6 89,333,925 (GRCm39) missense probably damaging 1.00
IGL02954:Plxna1 APN 6 89,301,649 (GRCm39) missense probably damaging 1.00
IGL03212:Plxna1 APN 6 89,308,885 (GRCm39) missense probably damaging 1.00
PIT4544001:Plxna1 UTSW 6 89,334,411 (GRCm39) missense probably benign 0.14
R0055:Plxna1 UTSW 6 89,306,721 (GRCm39) missense possibly damaging 0.94
R0055:Plxna1 UTSW 6 89,306,721 (GRCm39) missense possibly damaging 0.94
R0147:Plxna1 UTSW 6 89,297,692 (GRCm39) missense possibly damaging 0.95
R0149:Plxna1 UTSW 6 89,297,595 (GRCm39) missense probably null 0.95
R0166:Plxna1 UTSW 6 89,310,001 (GRCm39) missense probably damaging 1.00
R0200:Plxna1 UTSW 6 89,300,575 (GRCm39) missense probably damaging 1.00
R0415:Plxna1 UTSW 6 89,334,318 (GRCm39) missense probably benign 0.12
R0841:Plxna1 UTSW 6 89,309,186 (GRCm39) missense probably damaging 1.00
R1018:Plxna1 UTSW 6 89,319,942 (GRCm39) missense probably damaging 1.00
R1240:Plxna1 UTSW 6 89,298,032 (GRCm39) missense probably damaging 1.00
R1355:Plxna1 UTSW 6 89,297,748 (GRCm39) unclassified probably benign
R1700:Plxna1 UTSW 6 89,333,990 (GRCm39) missense probably damaging 1.00
R1776:Plxna1 UTSW 6 89,312,446 (GRCm39) missense probably benign 0.00
R1957:Plxna1 UTSW 6 89,308,273 (GRCm39) missense probably damaging 1.00
R2314:Plxna1 UTSW 6 89,301,298 (GRCm39) missense probably damaging 1.00
R2968:Plxna1 UTSW 6 89,319,590 (GRCm39) missense probably damaging 1.00
R3118:Plxna1 UTSW 6 89,333,958 (GRCm39) missense possibly damaging 0.89
R3522:Plxna1 UTSW 6 89,314,335 (GRCm39) critical splice acceptor site probably null
R3619:Plxna1 UTSW 6 89,334,435 (GRCm39) missense probably damaging 0.97
R3766:Plxna1 UTSW 6 89,311,757 (GRCm39) unclassified probably benign
R3847:Plxna1 UTSW 6 89,333,501 (GRCm39) missense probably damaging 1.00
R3849:Plxna1 UTSW 6 89,333,501 (GRCm39) missense probably damaging 1.00
R3872:Plxna1 UTSW 6 89,309,674 (GRCm39) nonsense probably null
R4555:Plxna1 UTSW 6 89,300,310 (GRCm39) missense probably damaging 0.99
R4709:Plxna1 UTSW 6 89,311,733 (GRCm39) missense possibly damaging 0.72
R4726:Plxna1 UTSW 6 89,299,798 (GRCm39) missense probably damaging 1.00
R4739:Plxna1 UTSW 6 89,309,657 (GRCm39) splice site probably null
R5053:Plxna1 UTSW 6 89,299,442 (GRCm39) missense probably damaging 1.00
R5221:Plxna1 UTSW 6 89,297,998 (GRCm39) missense probably damaging 1.00
R5449:Plxna1 UTSW 6 89,300,590 (GRCm39) missense probably damaging 1.00
R5480:Plxna1 UTSW 6 89,301,616 (GRCm39) missense probably damaging 1.00
R5575:Plxna1 UTSW 6 89,301,523 (GRCm39) missense possibly damaging 0.83
R5743:Plxna1 UTSW 6 89,333,511 (GRCm39) missense probably damaging 1.00
R5744:Plxna1 UTSW 6 89,311,664 (GRCm39) missense possibly damaging 0.67
R5754:Plxna1 UTSW 6 89,310,087 (GRCm39) missense possibly damaging 0.96
R5868:Plxna1 UTSW 6 89,299,704 (GRCm39) splice site probably benign
R5988:Plxna1 UTSW 6 89,334,522 (GRCm39) nonsense probably null
R6190:Plxna1 UTSW 6 89,333,586 (GRCm39) nonsense probably null
R6425:Plxna1 UTSW 6 89,311,647 (GRCm39) missense probably benign 0.00
R6561:Plxna1 UTSW 6 89,333,960 (GRCm39) missense probably damaging 1.00
R6623:Plxna1 UTSW 6 89,299,753 (GRCm39) missense probably damaging 1.00
R6638:Plxna1 UTSW 6 89,301,382 (GRCm39) missense probably damaging 0.97
R6701:Plxna1 UTSW 6 89,296,430 (GRCm39) missense probably damaging 0.99
R6825:Plxna1 UTSW 6 89,297,597 (GRCm39) missense probably benign 0.01
R6911:Plxna1 UTSW 6 89,297,956 (GRCm39) missense probably damaging 1.00
R7073:Plxna1 UTSW 6 89,334,311 (GRCm39) missense probably damaging 1.00
R7177:Plxna1 UTSW 6 89,300,311 (GRCm39) missense possibly damaging 0.50
R7235:Plxna1 UTSW 6 89,317,573 (GRCm39) missense probably damaging 0.97
R7419:Plxna1 UTSW 6 89,334,584 (GRCm39) missense unknown
R7511:Plxna1 UTSW 6 89,318,889 (GRCm39) missense possibly damaging 0.71
R7543:Plxna1 UTSW 6 89,299,837 (GRCm39) missense probably damaging 1.00
R7665:Plxna1 UTSW 6 89,301,520 (GRCm39) critical splice donor site probably null
R7678:Plxna1 UTSW 6 89,308,882 (GRCm39) missense probably damaging 0.99
R7748:Plxna1 UTSW 6 89,314,335 (GRCm39) critical splice acceptor site probably null
R7748:Plxna1 UTSW 6 89,314,334 (GRCm39) critical splice acceptor site probably null
R7877:Plxna1 UTSW 6 89,300,241 (GRCm39) missense probably damaging 0.99
R8025:Plxna1 UTSW 6 89,308,254 (GRCm39) missense probably damaging 1.00
R8171:Plxna1 UTSW 6 89,334,102 (GRCm39) missense probably benign 0.20
R8277:Plxna1 UTSW 6 89,334,162 (GRCm39) missense probably damaging 1.00
R8782:Plxna1 UTSW 6 89,300,220 (GRCm39) missense probably damaging 1.00
R8867:Plxna1 UTSW 6 89,310,079 (GRCm39) missense probably benign 0.00
R9245:Plxna1 UTSW 6 89,314,320 (GRCm39) missense probably damaging 1.00
R9253:Plxna1 UTSW 6 89,334,522 (GRCm39) nonsense probably null
R9269:Plxna1 UTSW 6 89,306,541 (GRCm39) missense probably null 1.00
R9273:Plxna1 UTSW 6 89,296,364 (GRCm39) missense possibly damaging 0.77
R9281:Plxna1 UTSW 6 89,300,313 (GRCm39) missense probably damaging 1.00
R9368:Plxna1 UTSW 6 89,314,138 (GRCm39) missense probably benign
R9440:Plxna1 UTSW 6 89,318,912 (GRCm39) missense probably benign 0.00
R9526:Plxna1 UTSW 6 89,319,633 (GRCm39) missense probably benign
R9601:Plxna1 UTSW 6 89,308,253 (GRCm39) missense probably damaging 1.00
R9714:Plxna1 UTSW 6 89,296,440 (GRCm39) missense probably damaging 0.99
R9782:Plxna1 UTSW 6 89,333,817 (GRCm39) missense probably benign 0.01
V8831:Plxna1 UTSW 6 89,334,119 (GRCm39) missense probably damaging 0.99
Z1176:Plxna1 UTSW 6 89,298,034 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAGTATTCTGATTTGCCATCGATG -3'
(R):5'- ACCTTTGTGGCCAGTGACTG -3'

Sequencing Primer
(F):5'- TGTGCCCACGAAGAGCTTG -3'
(R):5'- AGTGACTGGGGCCTCACTC -3'
Posted On 2016-05-10