Mutagenetix > Incidental Mutation

Incidental Mutation 'S24628:Plxna1'

385658

Institutional Source

Beutler Lab

Gene Symbol

Plxna1

Ensembl Gene

ENSMUSG00000030084

Gene Name

plexin A1

Synonyms

NOV, Plxn1, PlexA1, 2600013D04Rik

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.925) question?

Stock #

S24628 () of strain waterfowl

Quality Score

222

Status

Not validated

Chromosome

Chromosomal Location

89316314-89362620 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 89357336 bp (GRCm38)

Zygosity

Homozygous

Amino Acid Change

Histidine to Tyrosine at position 104 (H104Y)

Ref Sequence

ENSEMBL: ENSMUSP00000063066 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049845] [ENSMUST00000163139]

AlphaFold

P70206

PDB Structure

The Plexin A1 intracellular region in complex with Rac1 [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000049845
AA Change: H104Y

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000063066
Gene: ENSMUSG00000030084
AA Change: H104Y

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Sema	49	494	7.43e-126	SMART
PSI	512	562	6.4e-11	SMART
PSI	658	705	9.78e-7	SMART
low complexity region	759	772	N/A	INTRINSIC
PSI	806	860	7.24e-10	SMART
IPT	861	957	3.2e-26	SMART
IPT	958	1043	1.59e-21	SMART
IPT	1045	1145	6.86e-26	SMART
IPT	1147	1242	1.64e-5	SMART
transmembrane domain	1243	1265	N/A	INTRINSIC
Pfam:Plexin_cytopl	1316	1864	8.8e-263	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000163139
AA Change: H104Y

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000131840
Gene: ENSMUSG00000030084
AA Change: H104Y

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Sema	49	494	7.43e-126	SMART
PSI	512	562	6.4e-11	SMART
PSI	658	705	9.78e-7	SMART
low complexity region	759	772	N/A	INTRINSIC
PSI	806	860	7.24e-10	SMART
IPT	861	957	3.2e-26	SMART
IPT	958	1043	1.59e-21	SMART
IPT	1045	1145	6.86e-26	SMART
IPT	1147	1242	1.64e-5	SMART
transmembrane domain	1243	1265	N/A	INTRINSIC
Pfam:Plexin_cytopl	1315	1864	2.5e-264	PFAM

Meta Mutation Damage Score

0.1593

Coding Region Coverage

1x: 98.1%
3x: 97.0%
10x: 94.3%
20x: 88.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit bone cellularity abnormalities, altered dendritic cell physiology, abnormal proprioceptive and oligodendrocyte morphology, and increased lymphatic branching complexity and LEC numbers. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgre4	G	A	17: 55,852,288	V658I	probably benign	Het
Ccdc40	T	C	11: 119,232,118	Y249H	possibly damaging	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Homo
Gbp4	G	A	5: 105,121,106	R394C	possibly damaging	Het
Gpr183	C	A	14: 121,954,476	C211F	probably damaging	Homo
Lcp1	A	T	14: 75,227,006	I556F	possibly damaging	Het
Letm1	G	A	5: 33,747,444	P513S	probably benign	Het
Letm1	G	A	5: 33,747,446	P512L	probably benign	Het
Msh3	A	G	13: 92,346,786	V283A	possibly damaging	Het
Nfkb2	G	T	19: 46,307,567	E170D	probably benign	Het
Npr3	C	A	15: 11,848,563	M439I	probably benign	Het
Olfr1023	A	T	2: 85,887,438	I213F	possibly damaging	Het
Olfr1034	A	T	2: 86,047,055	H191L	probably benign	Het
Pax5	G	A	4: 44,691,886	A120V	probably damaging	Het
Plcb1	A	G	2: 135,337,499	Y609C	probably damaging	Het
Rnf213	A	T	11: 119,414,469	I509F	probably damaging	Het
Ryr2	T	C	13: 11,869,156	S213G	probably damaging	Homo
Spint1	A	G	2: 119,245,615	T231A	probably damaging	Het
Tbcel	C	A	9: 42,444,500	C139F	probably benign	Het
Thbs2	A	C	17: 14,679,973	S573A	probably benign	Het
Tmem43	C	A	6: 91,482,318	P257Q	probably benign	Homo
Tmprss13	A	G	9: 45,337,132		probably null	Het
Tnc	C	T	4: 64,018,012	G229D	probably damaging	Homo
Ugt1a10	TTCATCA	TTCA	1: 88,216,158		probably benign	Het
Vmn1r196	T	A	13: 22,293,836	V215D	probably damaging	Homo
Vmn1r22	G	T	6: 57,900,332	T220K	probably benign	Homo
Vmn2r116	G	A	17: 23,387,279	M388I	possibly damaging	Het
Zap70	A	G	1: 36,770,811	M1V	probably null	Homo
Zfp282	A	G	6: 47,897,881	D340G	probably damaging	Homo
Zfp282	T	A	6: 47,905,053	I558N	possibly damaging	Homo

Other mutations in Plxna1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Plxna1	APN	6	89320998	missense	probably damaging	1.00
IGL01358:Plxna1	APN	6	89322750	missense	probably damaging	1.00
IGL01475:Plxna1	APN	6	89354888	missense	possibly damaging	0.92
IGL01480:Plxna1	APN	6	89344096	missense	possibly damaging	0.70
IGL01585:Plxna1	APN	6	89329556	critical splice donor site	probably null
IGL01804:Plxna1	APN	6	89329646	missense	probably damaging	1.00
IGL01909:Plxna1	APN	6	89332084	critical splice donor site	probably null
IGL01989:Plxna1	APN	6	89329414	nonsense	probably null
IGL02015:Plxna1	APN	6	89342451	missense	probably damaging	1.00
IGL02023:Plxna1	APN	6	89357332	missense	possibly damaging	0.88
IGL02668:Plxna1	APN	6	89357269	nonsense	probably null
IGL02703:Plxna1	APN	6	89356943	missense	probably damaging	1.00
IGL02954:Plxna1	APN	6	89324667	missense	probably damaging	1.00
IGL03212:Plxna1	APN	6	89331903	missense	probably damaging	1.00
PIT4544001:Plxna1	UTSW	6	89357429	missense	probably benign	0.14
R0055:Plxna1	UTSW	6	89329739	missense	possibly damaging	0.94
R0055:Plxna1	UTSW	6	89329739	missense	possibly damaging	0.94
R0147:Plxna1	UTSW	6	89320710	missense	possibly damaging	0.95
R0149:Plxna1	UTSW	6	89320613	missense	probably null	0.95
R0166:Plxna1	UTSW	6	89333019	missense	probably damaging	1.00
R0200:Plxna1	UTSW	6	89323593	missense	probably damaging	1.00
R0415:Plxna1	UTSW	6	89357336	missense	probably benign	0.12
R0841:Plxna1	UTSW	6	89332204	missense	probably damaging	1.00
R1018:Plxna1	UTSW	6	89342960	missense	probably damaging	1.00
R1240:Plxna1	UTSW	6	89321050	missense	probably damaging	1.00
R1355:Plxna1	UTSW	6	89320766	unclassified	probably benign
R1700:Plxna1	UTSW	6	89357008	missense	probably damaging	1.00
R1776:Plxna1	UTSW	6	89335464	missense	probably benign	0.00
R1957:Plxna1	UTSW	6	89331291	missense	probably damaging	1.00
R2314:Plxna1	UTSW	6	89324316	missense	probably damaging	1.00
R2968:Plxna1	UTSW	6	89342608	missense	probably damaging	1.00
R3118:Plxna1	UTSW	6	89356976	missense	possibly damaging	0.89
R3522:Plxna1	UTSW	6	89337353	critical splice acceptor site	probably null
R3619:Plxna1	UTSW	6	89357453	missense	probably damaging	0.97
R3766:Plxna1	UTSW	6	89334775	unclassified	probably benign
R3847:Plxna1	UTSW	6	89356519	missense	probably damaging	1.00
R3849:Plxna1	UTSW	6	89356519	missense	probably damaging	1.00
R3872:Plxna1	UTSW	6	89332692	nonsense	probably null
R4555:Plxna1	UTSW	6	89323328	missense	probably damaging	0.99
R4709:Plxna1	UTSW	6	89334751	missense	possibly damaging	0.72
R4726:Plxna1	UTSW	6	89322816	missense	probably damaging	1.00
R4739:Plxna1	UTSW	6	89332675	splice site	probably null
R5053:Plxna1	UTSW	6	89322460	missense	probably damaging	1.00
R5221:Plxna1	UTSW	6	89321016	missense	probably damaging	1.00
R5449:Plxna1	UTSW	6	89323608	missense	probably damaging	1.00
R5480:Plxna1	UTSW	6	89324634	missense	probably damaging	1.00
R5575:Plxna1	UTSW	6	89324541	missense	possibly damaging	0.83
R5743:Plxna1	UTSW	6	89356529	missense	probably damaging	1.00
R5744:Plxna1	UTSW	6	89334682	missense	possibly damaging	0.67
R5754:Plxna1	UTSW	6	89333105	missense	possibly damaging	0.96
R5868:Plxna1	UTSW	6	89322722	splice site	probably benign
R5988:Plxna1	UTSW	6	89357540	nonsense	probably null
R6190:Plxna1	UTSW	6	89356604	nonsense	probably null
R6425:Plxna1	UTSW	6	89334665	missense	probably benign	0.00
R6561:Plxna1	UTSW	6	89356978	missense	probably damaging	1.00
R6623:Plxna1	UTSW	6	89322771	missense	probably damaging	1.00
R6638:Plxna1	UTSW	6	89324400	missense	probably damaging	0.97
R6701:Plxna1	UTSW	6	89319448	missense	probably damaging	0.99
R6825:Plxna1	UTSW	6	89320615	missense	probably benign	0.01
R6911:Plxna1	UTSW	6	89320974	missense	probably damaging	1.00
R7073:Plxna1	UTSW	6	89357329	missense	probably damaging	1.00
R7177:Plxna1	UTSW	6	89323329	missense	possibly damaging	0.50
R7235:Plxna1	UTSW	6	89340591	missense	probably damaging	0.97
R7419:Plxna1	UTSW	6	89357602	missense	unknown
R7511:Plxna1	UTSW	6	89341907	missense	possibly damaging	0.71
R7543:Plxna1	UTSW	6	89322855	missense	probably damaging	1.00
R7665:Plxna1	UTSW	6	89324538	critical splice donor site	probably null
R7678:Plxna1	UTSW	6	89331900	missense	probably damaging	0.99
R7748:Plxna1	UTSW	6	89337352	critical splice acceptor site	probably null
R7748:Plxna1	UTSW	6	89337353	critical splice acceptor site	probably null
R7877:Plxna1	UTSW	6	89323259	missense	probably damaging	0.99
R8025:Plxna1	UTSW	6	89331272	missense	probably damaging	1.00
R8171:Plxna1	UTSW	6	89357120	missense	probably benign	0.20
R8277:Plxna1	UTSW	6	89357180	missense	probably damaging	1.00
R8782:Plxna1	UTSW	6	89323238	missense	probably damaging	1.00
R8867:Plxna1	UTSW	6	89333097	missense	probably benign	0.00
R9245:Plxna1	UTSW	6	89337338	missense	probably damaging	1.00
R9253:Plxna1	UTSW	6	89357540	nonsense	probably null
R9269:Plxna1	UTSW	6	89329559	missense	probably null	1.00
R9273:Plxna1	UTSW	6	89319382	missense	possibly damaging	0.77
R9281:Plxna1	UTSW	6	89323331	missense	probably damaging	1.00
R9368:Plxna1	UTSW	6	89337156	missense	probably benign
R9440:Plxna1	UTSW	6	89341930	missense	probably benign	0.00
R9526:Plxna1	UTSW	6	89342651	missense	probably benign
R9601:Plxna1	UTSW	6	89331271	missense	probably damaging	1.00
R9714:Plxna1	UTSW	6	89319458	missense	probably damaging	0.99
R9782:Plxna1	UTSW	6	89356835	missense	probably benign	0.01
V8831:Plxna1	UTSW	6	89357137	missense	probably damaging	0.99
Z1176:Plxna1	UTSW	6	89321052	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAAGTATTCTGATTTGCCATCGATG -3'
(R):5'- ACCTTTGTGGCCAGTGACTG -3'

Sequencing Primer
(F):5'- TGTGCCCACGAAGAGCTTG -3'
(R):5'- AGTGACTGGGGCCTCACTC -3'

Posted On

2016-05-10