Mutagenetix > Incidental Mutation

Incidental Mutation 'S24628:Ccdc40'

385662

Institutional Source

Beutler Lab

Gene Symbol

Ccdc40

Ensembl Gene

ENSMUSG00000039963

Gene Name

coiled-coil domain containing 40

Synonyms

B930008I02Rik

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.238) question?

Stock #

S24628 () of strain waterfowl

Quality Score

208

Status

Not validated

Chromosome

Chromosomal Location

119228572-119265236 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 119232118 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 249 (Y249H)

Ref Sequence

ENSEMBL: ENSMUSP00000062198 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035935] [ENSMUST00000036113] [ENSMUST00000053440] [ENSMUST00000207655]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000035935
AA Change: Y179H

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000039463
Gene: ENSMUSG00000039963
AA Change: Y179H

Domain	Start	End	E-Value	Type
internal_repeat_1	7	48	1.25e-8	PROSPERO
internal_repeat_1	55	96	1.25e-8	PROSPERO
low complexity region	159	170	N/A	INTRINSIC
low complexity region	208	232	N/A	INTRINSIC
coiled coil region	349	371	N/A	INTRINSIC
coiled coil region	423	447	N/A	INTRINSIC
Blast:HisKA	450	519	3e-13	BLAST
Blast:HisKA	574	629	5e-8	BLAST
low complexity region	793	805	N/A	INTRINSIC
Pfam:BRE1	830	928	4.2e-20	PFAM
coiled coil region	1044	1112	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000036113

SMART Domains

Protein: ENSMUSP00000048516
Gene: ENSMUSG00000039976

Domain	Start	End	E-Value	Type
low complexity region	17	30	N/A	INTRINSIC
Blast:TBC	63	362	5e-75	BLAST
Blast:TBC	373	418	2e-13	BLAST
TBC	421	659	4.39e-43	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000053440
AA Change: Y249H

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000062198
Gene: ENSMUSG00000039963
AA Change: Y249H

Domain	Start	End	E-Value	Type
low complexity region	5	27	N/A	INTRINSIC
low complexity region	56	70	N/A	INTRINSIC
internal_repeat_1	79	114	5.57e-8	PROSPERO
internal_repeat_1	111	150	5.57e-8	PROSPERO
low complexity region	229	240	N/A	INTRINSIC
low complexity region	278	302	N/A	INTRINSIC
coiled coil region	419	441	N/A	INTRINSIC
coiled coil region	493	517	N/A	INTRINSIC
Blast:HisKA	520	589	2e-13	BLAST
Blast:HisKA	644	699	4e-8	BLAST
low complexity region	863	875	N/A	INTRINSIC
Pfam:BRE1	900	998	4e-20	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147037

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150358

Predicted Effect

probably benign
Transcript: ENSMUST00000207655

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 98.1%
3x: 97.0%
10x: 94.3%
20x: 88.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is necessary for motile cilia function. It functions in correct left-right axis formation by regulating the assembly of the inner dynein arm and the dynein regulatory complexes, which control ciliary beat. Mutations in this gene cause ciliary dyskinesia type 15, a disorder due to defects in cilia motility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit heterotaxia, hydrocephalus, short embryonic cilia, and postnatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgre4	G	A	17: 55,852,288	V658I	probably benign	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Homo
Gbp4	G	A	5: 105,121,106	R394C	possibly damaging	Het
Gpr183	C	A	14: 121,954,476	C211F	probably damaging	Homo
Lcp1	A	T	14: 75,227,006	I556F	possibly damaging	Het
Letm1	G	A	5: 33,747,444	P513S	probably benign	Het
Letm1	G	A	5: 33,747,446	P512L	probably benign	Het
Msh3	A	G	13: 92,346,786	V283A	possibly damaging	Het
Nfkb2	G	T	19: 46,307,567	E170D	probably benign	Het
Npr3	C	A	15: 11,848,563	M439I	probably benign	Het
Olfr1023	A	T	2: 85,887,438	I213F	possibly damaging	Het
Olfr1034	A	T	2: 86,047,055	H191L	probably benign	Het
Pax5	G	A	4: 44,691,886	A120V	probably damaging	Het
Plcb1	A	G	2: 135,337,499	Y609C	probably damaging	Het
Plxna1	G	A	6: 89,357,336	H104Y	probably benign	Homo
Rnf213	A	T	11: 119,414,469	I509F	probably damaging	Het
Ryr2	T	C	13: 11,869,156	S213G	probably damaging	Homo
Spint1	A	G	2: 119,245,615	T231A	probably damaging	Het
Tbcel	C	A	9: 42,444,500	C139F	probably benign	Het
Thbs2	A	C	17: 14,679,973	S573A	probably benign	Het
Tmem43	C	A	6: 91,482,318	P257Q	probably benign	Homo
Tmprss13	A	G	9: 45,337,132		probably null	Het
Tnc	C	T	4: 64,018,012	G229D	probably damaging	Homo
Ugt1a10	TTCATCA	TTCA	1: 88,216,158		probably benign	Het
Vmn1r196	T	A	13: 22,293,836	V215D	probably damaging	Homo
Vmn1r22	G	T	6: 57,900,332	T220K	probably benign	Homo
Vmn2r116	G	A	17: 23,387,279	M388I	possibly damaging	Het
Zap70	A	G	1: 36,770,811	M1V	probably null	Homo
Zfp282	A	G	6: 47,897,881	D340G	probably damaging	Homo
Zfp282	T	A	6: 47,905,053	I558N	possibly damaging	Homo

Other mutations in Ccdc40

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01538:Ccdc40	APN	11	119242719	missense	possibly damaging	0.90
IGL01864:Ccdc40	APN	11	119243085	missense	probably benign	0.23
IGL01911:Ccdc40	APN	11	119231971	splice site	probably null
IGL02640:Ccdc40	APN	11	119238078	missense	probably benign	0.18
IGL03278:Ccdc40	APN	11	119242510	missense	probably damaging	1.00
IGL03054:Ccdc40	UTSW	11	119263201	missense	possibly damaging	0.69
PIT4151001:Ccdc40	UTSW	11	119242451	missense	probably damaging	1.00
R0139:Ccdc40	UTSW	11	119264299	missense	probably benign	0.00
R0140:Ccdc40	UTSW	11	119264299	missense	probably benign	0.00
R0415:Ccdc40	UTSW	11	119232118	missense	possibly damaging	0.92
R0617:Ccdc40	UTSW	11	119242804	missense	probably damaging	1.00
R1396:Ccdc40	UTSW	11	119231803	missense	possibly damaging	0.66
R1531:Ccdc40	UTSW	11	119263189	missense	probably benign	0.01
R1751:Ccdc40	UTSW	11	119230696	critical splice donor site	probably null
R1767:Ccdc40	UTSW	11	119230696	critical splice donor site	probably null
R1870:Ccdc40	UTSW	11	119259904	missense	possibly damaging	0.81
R1971:Ccdc40	UTSW	11	119263075	splice site	probably null
R2106:Ccdc40	UTSW	11	119264297	missense	probably damaging	1.00
R2370:Ccdc40	UTSW	11	119263117	missense	probably benign	0.00
R3421:Ccdc40	UTSW	11	119234779	missense	probably benign	0.02
R3746:Ccdc40	UTSW	11	119264426	missense	probably benign	0.26
R3749:Ccdc40	UTSW	11	119264426	missense	probably benign	0.26
R3871:Ccdc40	UTSW	11	119264281	missense	probably damaging	1.00
R4508:Ccdc40	UTSW	11	119242509	missense	probably damaging	0.98
R4613:Ccdc40	UTSW	11	119231532	missense	probably benign	0.09
R4663:Ccdc40	UTSW	11	119231506	missense	probably benign	0.01
R4787:Ccdc40	UTSW	11	119253621	missense	possibly damaging	0.74
R4867:Ccdc40	UTSW	11	119231788	missense	probably benign
R5237:Ccdc40	UTSW	11	119259976	missense	probably benign	0.00
R5661:Ccdc40	UTSW	11	119237927	missense	probably benign	0.13
R5678:Ccdc40	UTSW	11	119231572	missense	possibly damaging	0.61
R5805:Ccdc40	UTSW	11	119246080	critical splice donor site	probably null
R5830:Ccdc40	UTSW	11	119242746	missense	probably benign	0.00
R5895:Ccdc40	UTSW	11	119253403	missense	probably damaging	1.00
R5932:Ccdc40	UTSW	11	119251012	missense	probably damaging	0.98
R6034:Ccdc40	UTSW	11	119243072	missense	possibly damaging	0.70
R6034:Ccdc40	UTSW	11	119243072	missense	possibly damaging	0.70
R6109:Ccdc40	UTSW	11	119231978	missense	probably benign
R6166:Ccdc40	UTSW	11	119232001	missense	probably benign
R6336:Ccdc40	UTSW	11	119231993	missense	possibly damaging	0.82
R6569:Ccdc40	UTSW	11	119242734	missense	probably damaging	1.00
R6884:Ccdc40	UTSW	11	119242739	missense	possibly damaging	0.82
R7022:Ccdc40	UTSW	11	119231786	missense	possibly damaging	0.82
R7212:Ccdc40	UTSW	11	119264444	missense	probably damaging	0.99
R7472:Ccdc40	UTSW	11	119263148	missense	probably benign	0.30
R7522:Ccdc40	UTSW	11	119232221	missense	possibly damaging	0.73
R7888:Ccdc40	UTSW	11	119229141	missense	unknown
R8041:Ccdc40	UTSW	11	119231681	missense	possibly damaging	0.53
R8117:Ccdc40	UTSW	11	119253385	missense	probably benign	0.00
R8162:Ccdc40	UTSW	11	119260044	critical splice donor site	probably null
R8514:Ccdc40	UTSW	11	119230633	missense	unknown
R8725:Ccdc40	UTSW	11	119264497	missense	probably benign
R8727:Ccdc40	UTSW	11	119264497	missense	probably benign
R8799:Ccdc40	UTSW	11	119264466	missense	probably benign	0.00
R8877:Ccdc40	UTSW	11	119263166	missense	probably damaging	1.00
R9304:Ccdc40	UTSW	11	119231771	missense	probably benign	0.06
Z1176:Ccdc40	UTSW	11	119252008	missense	probably damaging	1.00
Z1177:Ccdc40	UTSW	11	119238107	missense	probably damaging	0.96
Z1177:Ccdc40	UTSW	11	119254398	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- GTGGACTCCATTAGGAAGGC -3'
(R):5'- TGGTACAAACACTCACCGTG -3'

Sequencing Primer
(F):5'- CCTCCGAGGAATAGACTTGGAATC -3'
(R):5'- ACCGTGCTGTCCTCTGG -3'

Posted On

2016-05-10