Mutagenetix > Incidental Mutation

Incidental Mutation 'S24628:Vmn1r196'

385666

Institutional Source

Beutler Lab

Gene Symbol

Vmn1r196

Ensembl Gene

ENSMUSG00000069295

Gene Name

vomeronasal 1 receptor 196

Synonyms

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.061) question?

Stock #

S24628 () of strain waterfowl

Quality Score

222

Status

Not validated

Chromosome

Chromosomal Location

22289920-22298360 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 22293836 bp (GRCm38)

Zygosity

Homozygous

Amino Acid Change

Valine to Aspartic acid at position 215 (V215D)

Ref Sequence

ENSEMBL: ENSMUSP00000154145 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091735] [ENSMUST00000226245] [ENSMUST00000227516] [ENSMUST00000228382] [ENSMUST00000228557]

AlphaFold

Q5SVD5

Predicted Effect

probably damaging
Transcript: ENSMUST00000091735
AA Change: V215D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000089329
Gene: ENSMUSG00000069295
AA Change: V215D

Domain	Start	End	E-Value	Type
Pfam:V1R	35	297	3.9e-35	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000120610

Predicted Effect

probably damaging
Transcript: ENSMUST00000226245
AA Change: V138D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000227516
AA Change: V30D

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

Predicted Effect

probably damaging
Transcript: ENSMUST00000228382
AA Change: V215D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000228557
AA Change: V215D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 98.1%
3x: 97.0%
10x: 94.3%
20x: 88.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgre4	G	A	17: 55,852,288	V658I	probably benign	Het
Ccdc40	T	C	11: 119,232,118	Y249H	possibly damaging	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Homo
Gbp4	G	A	5: 105,121,106	R394C	possibly damaging	Het
Gpr183	C	A	14: 121,954,476	C211F	probably damaging	Homo
Lcp1	A	T	14: 75,227,006	I556F	possibly damaging	Het
Letm1	G	A	5: 33,747,444	P513S	probably benign	Het
Letm1	G	A	5: 33,747,446	P512L	probably benign	Het
Msh3	A	G	13: 92,346,786	V283A	possibly damaging	Het
Nfkb2	G	T	19: 46,307,567	E170D	probably benign	Het
Npr3	C	A	15: 11,848,563	M439I	probably benign	Het
Olfr1023	A	T	2: 85,887,438	I213F	possibly damaging	Het
Olfr1034	A	T	2: 86,047,055	H191L	probably benign	Het
Pax5	G	A	4: 44,691,886	A120V	probably damaging	Het
Plcb1	A	G	2: 135,337,499	Y609C	probably damaging	Het
Plxna1	G	A	6: 89,357,336	H104Y	probably benign	Homo
Rnf213	A	T	11: 119,414,469	I509F	probably damaging	Het
Ryr2	T	C	13: 11,869,156	S213G	probably damaging	Homo
Spint1	A	G	2: 119,245,615	T231A	probably damaging	Het
Tbcel	C	A	9: 42,444,500	C139F	probably benign	Het
Thbs2	A	C	17: 14,679,973	S573A	probably benign	Het
Tmem43	C	A	6: 91,482,318	P257Q	probably benign	Homo
Tmprss13	A	G	9: 45,337,132		probably null	Het
Tnc	C	T	4: 64,018,012	G229D	probably damaging	Homo
Ugt1a10	TTCATCA	TTCA	1: 88,216,158		probably benign	Het
Vmn1r22	G	T	6: 57,900,332	T220K	probably benign	Homo
Vmn2r116	G	A	17: 23,387,279	M388I	possibly damaging	Het
Zap70	A	G	1: 36,770,811	M1V	probably null	Homo
Zfp282	A	G	6: 47,897,881	D340G	probably damaging	Homo
Zfp282	T	A	6: 47,905,053	I558N	possibly damaging	Homo

Other mutations in Vmn1r196

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01941:Vmn1r196	APN	13	22293699	nonsense	probably null
R0415:Vmn1r196	UTSW	13	22293836	missense	probably damaging	1.00
R0502:Vmn1r196	UTSW	13	22293387	missense	probably benign	0.01
R0503:Vmn1r196	UTSW	13	22293387	missense	probably benign	0.01
R2306:Vmn1r196	UTSW	13	22293303	missense	probably benign	0.08
R4463:Vmn1r196	UTSW	13	22293683	missense	probably benign
R6335:Vmn1r196	UTSW	13	22293717	missense	probably benign	0.18
R7664:Vmn1r196	UTSW	13	22293762	missense	probably damaging	1.00
R8062:Vmn1r196	UTSW	13	22293270	missense	probably damaging	1.00
R9017:Vmn1r196	UTSW	13	22294084	missense	probably benign	0.00
R9434:Vmn1r196	UTSW	13	22293620	nonsense	probably null
R9583:Vmn1r196	UTSW	13	22293750	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- ACACCTTACAACTGAGGCAG -3'
(R):5'- TCCCTCTGAATCAGCATAAATGGG -3'

Sequencing Primer
(F):5'- CACCTTACAACTGAGGCAGATTAGTG -3'
(R):5'- TGGGCTAAGAACTGCATAACC -3'

Posted On

2016-05-10