Mutagenetix > Incidental Mutations

Incidental Mutation 'S24628:Msh3'

385667

Institutional Source

Beutler Lab

Gene Symbol

Msh3

Ensembl Gene

ENSMUSG00000014850

Gene Name

mutS homolog 3

Synonyms

Rep3, Rep-3, D13Em1

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.420) question?

Stock #

S24628 () of strain waterfowl

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

92211872-92355003 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 92346786 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 283 (V283A)

Ref Sequence

ENSEMBL: ENSMUSP00000022220 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022220] [ENSMUST00000185852] [ENSMUST00000187424] [ENSMUST00000187874] [ENSMUST00000190393] [ENSMUST00000191509] [ENSMUST00000191550]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000022220
AA Change: V283A

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000022220
Gene: ENSMUSG00000014850
AA Change: V283A

Domain	Start	End	E-Value	Type
low complexity region	4	19	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC
Pfam:MutS_I	188	301	1.6e-35	PFAM
Pfam:MutS_II	324	481	2.2e-36	PFAM
MUTSd	513	828	7.62e-97	SMART
MUTSac	847	1049	9.7e-122	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000185852
AA Change: V283A

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000140002
Gene: ENSMUSG00000014850
AA Change: V283A

Domain	Start	End	E-Value	Type
low complexity region	4	19	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC
Pfam:MutS_I	188	301	7.2e-35	PFAM
Pfam:MutS_II	324	481	2.2e-36	PFAM
MUTSd	513	828	7.62e-97	SMART
MUTSac	847	1049	9.7e-122	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186878

Predicted Effect

probably benign
Transcript: ENSMUST00000187424

SMART Domains

Protein: ENSMUSP00000139622
Gene: ENSMUSG00000014850

Domain	Start	End	E-Value	Type
low complexity region	4	19	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187831

Predicted Effect

probably benign
Transcript: ENSMUST00000187874

SMART Domains

Protein: ENSMUSP00000139620
Gene: ENSMUSG00000014850

Domain	Start	End	E-Value	Type
low complexity region	4	19	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189376

Predicted Effect

probably benign
Transcript: ENSMUST00000190393

SMART Domains

Protein: ENSMUSP00000141163
Gene: ENSMUSG00000014850

Domain	Start	End	E-Value	Type
low complexity region	4	19	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC
Pfam:MutS_I	188	241	6.4e-10	PFAM
low complexity region	261	285	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000191509

SMART Domains

Protein: ENSMUSP00000141158
Gene: ENSMUSG00000014850

Domain	Start	End	E-Value	Type
low complexity region	4	19	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000191550

SMART Domains

Protein: ENSMUSP00000140659
Gene: ENSMUSG00000014850

Domain	Start	End	E-Value	Type
low complexity region	4	19	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 98.1%
3x: 97.0%
10x: 94.3%
20x: 88.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a heterodimer with MSH2 to form MutS beta, part of the post-replicative DNA mismatch repair system. MutS beta initiates mismatch repair by binding to a mismatch and then forming a complex with MutL alpha heterodimer. This gene contains a polymorphic 9 bp tandem repeat sequence in the first exon. The repeat is present 6 times in the reference genome sequence and 3-7 repeats have been reported. Defects in this gene are a cause of susceptibility to endometrial cancer. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a partial defect mismatch repair and development of intestinal tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgre4	G	A	17: 55,852,288	V658I	probably benign	Het
Ccdc40	T	C	11: 119,232,118	Y249H	possibly damaging	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Homo
Gbp4	G	A	5: 105,121,106	R394C	possibly damaging	Het
Gpr183	C	A	14: 121,954,476	C211F	probably damaging	Homo
Lcp1	A	T	14: 75,227,006	I556F	possibly damaging	Het
Letm1	G	A	5: 33,747,444	P513S	probably benign	Het
Letm1	G	A	5: 33,747,446	P512L	probably benign	Het
Nfkb2	G	T	19: 46,307,567	E170D	probably benign	Het
Npr3	C	A	15: 11,848,563	M439I	probably benign	Het
Olfr1023	A	T	2: 85,887,438	I213F	possibly damaging	Het
Olfr1034	A	T	2: 86,047,055	H191L	probably benign	Het
Pax5	G	A	4: 44,691,886	A120V	probably damaging	Het
Plcb1	A	G	2: 135,337,499	Y609C	probably damaging	Het
Plxna1	G	A	6: 89,357,336	H104Y	probably benign	Homo
Rnf213	A	T	11: 119,414,469	I509F	probably damaging	Het
Ryr2	T	C	13: 11,869,156	S213G	probably damaging	Homo
Spint1	A	G	2: 119,245,615	T231A	probably damaging	Het
Tbcel	C	A	9: 42,444,500	C139F	probably benign	Het
Thbs2	A	C	17: 14,679,973	S573A	probably benign	Het
Tmem43	C	A	6: 91,482,318	P257Q	probably benign	Homo
Tmprss13	A	G	9: 45,337,132		probably null	Het
Tnc	C	T	4: 64,018,012	G229D	probably damaging	Homo
Ugt1a10	TTCATCA	TTCA	1: 88,216,158		probably benign	Het
Vmn1r196	T	A	13: 22,293,836	V215D	probably damaging	Homo
Vmn1r22	G	T	6: 57,900,332	T220K	probably benign	Homo
Vmn2r116	G	A	17: 23,387,279	M388I	possibly damaging	Het
Zap70	A	G	1: 36,770,811	M1V	probably null	Homo
Zfp282	A	G	6: 47,897,881	D340G	probably damaging	Homo
Zfp282	T	A	6: 47,905,053	I558N	possibly damaging	Homo

Other mutations in Msh3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00895:Msh3	APN	13	92344964	missense	probably damaging	1.00
IGL00983:Msh3	APN	13	92300277	missense	probably damaging	1.00
IGL01490:Msh3	APN	13	92300305	missense	probably damaging	1.00
IGL02072:Msh3	APN	13	92300295	missense	probably damaging	1.00
IGL02313:Msh3	APN	13	92349312	missense	possibly damaging	0.86
IGL02711:Msh3	APN	13	92351311	missense	probably damaging	1.00
IGL03108:Msh3	APN	13	92221088	splice site	probably benign
IGL03227:Msh3	APN	13	92285960	missense	probably damaging	0.98
R0164:Msh3	UTSW	13	92349209	missense	probably damaging	1.00
R0164:Msh3	UTSW	13	92349209	missense	probably damaging	1.00
R0415:Msh3	UTSW	13	92346786	missense	possibly damaging	0.89
R0457:Msh3	UTSW	13	92220997	missense	probably damaging	1.00
R0659:Msh3	UTSW	13	92345096	missense	possibly damaging	0.80
R0661:Msh3	UTSW	13	92345096	missense	possibly damaging	0.80
R0686:Msh3	UTSW	13	92351431	missense	possibly damaging	0.53
R0688:Msh3	UTSW	13	92351431	missense	possibly damaging	0.53
R0707:Msh3	UTSW	13	92347340	nonsense	probably null
R1605:Msh3	UTSW	13	92300275	missense	probably null	1.00
R1622:Msh3	UTSW	13	92344954	critical splice donor site	probably null
R1771:Msh3	UTSW	13	92212496	missense	probably benign	0.05
R1970:Msh3	UTSW	13	92249820	splice site	probably benign
R1971:Msh3	UTSW	13	92223276	missense	probably damaging	1.00
R1971:Msh3	UTSW	13	92249820	splice site	probably benign
R2894:Msh3	UTSW	13	92342360	missense	probably benign	0.16
R3837:Msh3	UTSW	13	92354858	missense	probably damaging	1.00
R4119:Msh3	UTSW	13	92354011	intron	probably benign
R4225:Msh3	UTSW	13	92285923	missense	probably benign	0.03
R4881:Msh3	UTSW	13	92266041	intron	probably benign
R5118:Msh3	UTSW	13	92309434	splice site	probably benign
R5209:Msh3	UTSW	13	92344954	critical splice donor site	probably null
R5817:Msh3	UTSW	13	92286000	missense	possibly damaging	0.86
R5849:Msh3	UTSW	13	92249878	missense	possibly damaging	0.81
R5851:Msh3	UTSW	13	92215522	missense	probably benign	0.00
R5940:Msh3	UTSW	13	92249843	missense	probably damaging	1.00
R6004:Msh3	UTSW	13	92342414	critical splice acceptor site	probably null
R6363:Msh3	UTSW	13	92212524	missense	probably damaging	1.00
R6510:Msh3	UTSW	13	92353264	nonsense	probably null
R6654:Msh3	UTSW	13	92345042	missense	probably benign	0.01
R6853:Msh3	UTSW	13	92312572	critical splice donor site	probably null
R7022:Msh3	UTSW	13	92235588	missense	probably damaging	1.00
R7098:Msh3	UTSW	13	92274111	missense	possibly damaging	0.95
R7103:Msh3	UTSW	13	92274800	missense	probably benign
R7148:Msh3	UTSW	13	92354822	missense	probably benign	0.18
R7171:Msh3	UTSW	13	92349298	missense	probably benign	0.00
R7317:Msh3	UTSW	13	92286004	missense	probably damaging	1.00
R7369:Msh3	UTSW	13	92299262	missense	probably benign	0.15
R7586:Msh3	UTSW	13	92349332	utr 3 prime	probably benign
R7641:Msh3	UTSW	13	92212503	missense	probably benign	0.08
R7648:Msh3	UTSW	13	92274028	missense	probably damaging	1.00
R7674:Msh3	UTSW	13	92212503	missense	probably benign	0.08
R8125:Msh3	UTSW	13	92299182	missense	probably benign
X0027:Msh3	UTSW	13	92274070	missense	probably damaging	0.98
X0063:Msh3	UTSW	13	92274785	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTCTCACTGTGACAATGGACAC -3'
(R):5'- TCTGGACATGGAGGATGTTTCC -3'

Sequencing Primer
(F):5'- TGTGACAATGGACACATACCCG -3'
(R):5'- GGATGTTTCCTTATTTTCATTGCTTC -3'

Posted On

2016-05-10