Incidental Mutation 'S24628:Msh3'
ID 385667
Institutional Source Beutler Lab
Gene Symbol Msh3
Ensembl Gene ENSMUSG00000014850
Gene Name mutS homolog 3
Synonyms Rep3, D13Em1, Rep-3
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.285) question?
Stock # S24628 () of strain waterfowl
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 92348387-92491515 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 92483294 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 283 (V283A)
Ref Sequence ENSEMBL: ENSMUSP00000022220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022220] [ENSMUST00000185852] [ENSMUST00000187424] [ENSMUST00000187874] [ENSMUST00000190393] [ENSMUST00000191509] [ENSMUST00000191550]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000022220
AA Change: V283A

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022220
Gene: ENSMUSG00000014850
AA Change: V283A

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 301 1.6e-35 PFAM
Pfam:MutS_II 324 481 2.2e-36 PFAM
MUTSd 513 828 7.62e-97 SMART
MUTSac 847 1049 9.7e-122 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000185852
AA Change: V283A

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140002
Gene: ENSMUSG00000014850
AA Change: V283A

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 301 7.2e-35 PFAM
Pfam:MutS_II 324 481 2.2e-36 PFAM
MUTSd 513 828 7.62e-97 SMART
MUTSac 847 1049 9.7e-122 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186878
Predicted Effect probably benign
Transcript: ENSMUST00000187424
SMART Domains Protein: ENSMUSP00000139622
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187831
Predicted Effect probably benign
Transcript: ENSMUST00000187874
SMART Domains Protein: ENSMUSP00000139620
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189376
Predicted Effect probably benign
Transcript: ENSMUST00000190393
SMART Domains Protein: ENSMUSP00000141163
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 241 6.4e-10 PFAM
low complexity region 261 285 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191509
SMART Domains Protein: ENSMUSP00000141158
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191550
SMART Domains Protein: ENSMUSP00000140659
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.1%
  • 3x: 97.0%
  • 10x: 94.3%
  • 20x: 88.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a heterodimer with MSH2 to form MutS beta, part of the post-replicative DNA mismatch repair system. MutS beta initiates mismatch repair by binding to a mismatch and then forming a complex with MutL alpha heterodimer. This gene contains a polymorphic 9 bp tandem repeat sequence in the first exon. The repeat is present 6 times in the reference genome sequence and 3-7 repeats have been reported. Defects in this gene are a cause of susceptibility to endometrial cancer. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a partial defect mismatch repair and development of intestinal tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 G A 17: 56,159,288 (GRCm39) V658I probably benign Het
Ccdc40 T C 11: 119,122,944 (GRCm39) Y249H possibly damaging Het
D6Ertd527e C G 6: 87,088,506 (GRCm39) T223S unknown Homo
Gbp4 G A 5: 105,268,972 (GRCm39) R394C possibly damaging Het
Gpr183 C A 14: 122,191,888 (GRCm39) C211F probably damaging Homo
Lcp1 A T 14: 75,464,446 (GRCm39) I556F possibly damaging Het
Letm1 G A 5: 33,904,788 (GRCm39) P513S probably benign Het
Letm1 G A 5: 33,904,790 (GRCm39) P512L probably benign Het
Nfkb2 G T 19: 46,296,006 (GRCm39) E170D probably benign Het
Npr3 C A 15: 11,848,649 (GRCm39) M439I probably benign Het
Or5m10 A T 2: 85,717,782 (GRCm39) I213F possibly damaging Het
Or5m9 A T 2: 85,877,399 (GRCm39) H191L probably benign Het
Pax5 G A 4: 44,691,886 (GRCm39) A120V probably damaging Het
Plcb1 A G 2: 135,179,419 (GRCm39) Y609C probably damaging Het
Plxna1 G A 6: 89,334,318 (GRCm39) H104Y probably benign Homo
Rnf213 A T 11: 119,305,295 (GRCm39) I509F probably damaging Het
Ryr2 T C 13: 11,884,042 (GRCm39) S213G probably damaging Homo
Spint1 A G 2: 119,076,096 (GRCm39) T231A probably damaging Het
Tbcel C A 9: 42,355,796 (GRCm39) C139F probably benign Het
Thbs2 A C 17: 14,900,235 (GRCm39) S573A probably benign Het
Tmem43 C A 6: 91,459,300 (GRCm39) P257Q probably benign Homo
Tmprss13 A G 9: 45,248,430 (GRCm39) probably null Het
Tnc C T 4: 63,936,249 (GRCm39) G229D probably damaging Homo
Ugt1a10 TTCATCA TTCA 1: 88,143,880 (GRCm39) probably benign Het
Vmn1r196 T A 13: 22,478,006 (GRCm39) V215D probably damaging Homo
Vmn1r22 G T 6: 57,877,317 (GRCm39) T220K probably benign Homo
Vmn2r116 G A 17: 23,606,253 (GRCm39) M388I possibly damaging Het
Zap70 A G 1: 36,809,892 (GRCm39) M1V probably null Homo
Zfp282 A G 6: 47,874,815 (GRCm39) D340G probably damaging Homo
Zfp282 T A 6: 47,881,987 (GRCm39) I558N possibly damaging Homo
Other mutations in Msh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Msh3 APN 13 92,481,472 (GRCm39) missense probably damaging 1.00
IGL00983:Msh3 APN 13 92,436,785 (GRCm39) missense probably damaging 1.00
IGL01490:Msh3 APN 13 92,436,813 (GRCm39) missense probably damaging 1.00
IGL02072:Msh3 APN 13 92,436,803 (GRCm39) missense probably damaging 1.00
IGL02313:Msh3 APN 13 92,485,820 (GRCm39) missense possibly damaging 0.86
IGL02711:Msh3 APN 13 92,487,819 (GRCm39) missense probably damaging 1.00
IGL03108:Msh3 APN 13 92,357,596 (GRCm39) splice site probably benign
IGL03227:Msh3 APN 13 92,422,468 (GRCm39) missense probably damaging 0.98
R0164:Msh3 UTSW 13 92,485,717 (GRCm39) missense probably damaging 1.00
R0164:Msh3 UTSW 13 92,485,717 (GRCm39) missense probably damaging 1.00
R0415:Msh3 UTSW 13 92,483,294 (GRCm39) missense possibly damaging 0.89
R0457:Msh3 UTSW 13 92,357,505 (GRCm39) missense probably damaging 1.00
R0659:Msh3 UTSW 13 92,481,604 (GRCm39) missense possibly damaging 0.80
R0661:Msh3 UTSW 13 92,481,604 (GRCm39) missense possibly damaging 0.80
R0686:Msh3 UTSW 13 92,487,939 (GRCm39) missense possibly damaging 0.53
R0688:Msh3 UTSW 13 92,487,939 (GRCm39) missense possibly damaging 0.53
R0707:Msh3 UTSW 13 92,483,848 (GRCm39) nonsense probably null
R1605:Msh3 UTSW 13 92,436,783 (GRCm39) missense probably null 1.00
R1622:Msh3 UTSW 13 92,481,462 (GRCm39) critical splice donor site probably null
R1771:Msh3 UTSW 13 92,349,004 (GRCm39) missense probably benign 0.05
R1970:Msh3 UTSW 13 92,386,328 (GRCm39) splice site probably benign
R1971:Msh3 UTSW 13 92,386,328 (GRCm39) splice site probably benign
R1971:Msh3 UTSW 13 92,359,784 (GRCm39) missense probably damaging 1.00
R2894:Msh3 UTSW 13 92,478,868 (GRCm39) missense probably benign 0.16
R3837:Msh3 UTSW 13 92,491,366 (GRCm39) missense probably damaging 1.00
R4119:Msh3 UTSW 13 92,490,519 (GRCm39) intron probably benign
R4225:Msh3 UTSW 13 92,422,431 (GRCm39) missense probably benign 0.03
R4881:Msh3 UTSW 13 92,402,549 (GRCm39) intron probably benign
R5118:Msh3 UTSW 13 92,445,942 (GRCm39) splice site probably benign
R5209:Msh3 UTSW 13 92,481,462 (GRCm39) critical splice donor site probably null
R5817:Msh3 UTSW 13 92,422,508 (GRCm39) missense possibly damaging 0.86
R5849:Msh3 UTSW 13 92,386,386 (GRCm39) missense possibly damaging 0.81
R5851:Msh3 UTSW 13 92,352,030 (GRCm39) missense probably benign 0.00
R5940:Msh3 UTSW 13 92,386,351 (GRCm39) missense probably damaging 1.00
R6004:Msh3 UTSW 13 92,478,922 (GRCm39) critical splice acceptor site probably null
R6363:Msh3 UTSW 13 92,349,032 (GRCm39) missense probably damaging 1.00
R6510:Msh3 UTSW 13 92,489,772 (GRCm39) nonsense probably null
R6654:Msh3 UTSW 13 92,481,550 (GRCm39) missense probably benign 0.01
R6853:Msh3 UTSW 13 92,449,080 (GRCm39) critical splice donor site probably null
R7022:Msh3 UTSW 13 92,372,096 (GRCm39) missense probably damaging 1.00
R7098:Msh3 UTSW 13 92,410,619 (GRCm39) missense possibly damaging 0.95
R7103:Msh3 UTSW 13 92,411,308 (GRCm39) missense probably benign
R7148:Msh3 UTSW 13 92,491,330 (GRCm39) missense probably benign 0.18
R7171:Msh3 UTSW 13 92,485,806 (GRCm39) missense probably benign 0.00
R7317:Msh3 UTSW 13 92,422,512 (GRCm39) missense probably damaging 1.00
R7369:Msh3 UTSW 13 92,435,770 (GRCm39) missense probably benign 0.15
R7586:Msh3 UTSW 13 92,485,840 (GRCm39) utr 3 prime probably benign
R7641:Msh3 UTSW 13 92,349,011 (GRCm39) missense probably benign 0.08
R7648:Msh3 UTSW 13 92,410,536 (GRCm39) missense probably damaging 1.00
R7674:Msh3 UTSW 13 92,349,011 (GRCm39) missense probably benign 0.08
R8125:Msh3 UTSW 13 92,435,690 (GRCm39) missense probably benign
R8252:Msh3 UTSW 13 92,357,569 (GRCm39) missense probably damaging 1.00
R8388:Msh3 UTSW 13 92,359,784 (GRCm39) missense probably damaging 1.00
R8442:Msh3 UTSW 13 92,349,020 (GRCm39) missense probably benign 0.00
R8735:Msh3 UTSW 13 92,411,374 (GRCm39) missense possibly damaging 0.94
R8986:Msh3 UTSW 13 92,483,334 (GRCm39) missense probably damaging 1.00
R9264:Msh3 UTSW 13 92,485,812 (GRCm39) missense probably benign 0.00
R9326:Msh3 UTSW 13 92,400,307 (GRCm39) missense probably benign 0.15
R9457:Msh3 UTSW 13 92,481,594 (GRCm39) missense probably benign 0.04
R9459:Msh3 UTSW 13 92,352,047 (GRCm39) missense possibly damaging 0.91
R9648:Msh3 UTSW 13 92,478,757 (GRCm39) missense probably benign 0.00
X0027:Msh3 UTSW 13 92,410,578 (GRCm39) missense probably damaging 0.98
X0063:Msh3 UTSW 13 92,411,293 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCTCACTGTGACAATGGACAC -3'
(R):5'- TCTGGACATGGAGGATGTTTCC -3'

Sequencing Primer
(F):5'- TGTGACAATGGACACATACCCG -3'
(R):5'- GGATGTTTCCTTATTTTCATTGCTTC -3'
Posted On 2016-05-10