Incidental Mutation 'S24628:Gpr183'
ID 385669
Institutional Source Beutler Lab
Gene Symbol Gpr183
Ensembl Gene ENSMUSG00000051212
Gene Name G protein-coupled receptor 183
Synonyms Ebi2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # S24628 () of strain waterfowl
Quality Score 222
Status Not validated
Chromosome 14
Chromosomal Location 121952551-121965195 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 121954476 bp (GRCm38)
Zygosity Homozygous
Amino Acid Change Cysteine to Phenylalanine at position 211 (C211F)
Ref Sequence ENSEMBL: ENSMUSP00000052404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039803] [ENSMUST00000049872] [ENSMUST00000226998] [ENSMUST00000227267]
AlphaFold Q3U6B2
Predicted Effect probably benign
Transcript: ENSMUST00000039803
SMART Domains Protein: ENSMUSP00000043245
Gene: ENSMUSG00000041765

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 92 114 N/A INTRINSIC
transmembrane domain 129 151 N/A INTRINSIC
transmembrane domain 164 186 N/A INTRINSIC
low complexity region 261 269 N/A INTRINSIC
UBA 307 344 1.11e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000049872
AA Change: C211F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052404
Gene: ENSMUSG00000051212
AA Change: C211F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 35 167 4.6e-9 PFAM
Pfam:7TM_GPCR_Srsx 38 319 4e-10 PFAM
Pfam:7tm_1 44 304 1.4e-47 PFAM
low complexity region 323 334 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226998
Predicted Effect probably benign
Transcript: ENSMUST00000227267
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227684
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227936
Coding Region Coverage
  • 1x: 98.1%
  • 3x: 97.0%
  • 10x: 94.3%
  • 20x: 88.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by the up-regulation of its expression upon Epstein-Barr virus infection of primary B lymphocytes. This gene is predicted to encode a G protein-coupled receptor that is most closely related to the thrombin receptor. Expression of this gene was detected in B-lymphocyte cell lines and lymphoid tissues but not in T-lymphocyte cell lines or peripheral blood T lymphocytes. The function of this gene is unknown. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to altered B cell migration during immune activation. Mice homozygous for a null allele exhibit decreased plasmacytoid and myeloid dendritic cell number, and increased type I interferon responses upon TLR ligand challenge or viral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 G A 17: 55,852,288 V658I probably benign Het
Ccdc40 T C 11: 119,232,118 Y249H possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Homo
Gbp4 G A 5: 105,121,106 R394C possibly damaging Het
Lcp1 A T 14: 75,227,006 I556F possibly damaging Het
Letm1 G A 5: 33,747,444 P513S probably benign Het
Letm1 G A 5: 33,747,446 P512L probably benign Het
Msh3 A G 13: 92,346,786 V283A possibly damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Npr3 C A 15: 11,848,563 M439I probably benign Het
Olfr1023 A T 2: 85,887,438 I213F possibly damaging Het
Olfr1034 A T 2: 86,047,055 H191L probably benign Het
Pax5 G A 4: 44,691,886 A120V probably damaging Het
Plcb1 A G 2: 135,337,499 Y609C probably damaging Het
Plxna1 G A 6: 89,357,336 H104Y probably benign Homo
Rnf213 A T 11: 119,414,469 I509F probably damaging Het
Ryr2 T C 13: 11,869,156 S213G probably damaging Homo
Spint1 A G 2: 119,245,615 T231A probably damaging Het
Tbcel C A 9: 42,444,500 C139F probably benign Het
Thbs2 A C 17: 14,679,973 S573A probably benign Het
Tmem43 C A 6: 91,482,318 P257Q probably benign Homo
Tmprss13 A G 9: 45,337,132 probably null Het
Tnc C T 4: 64,018,012 G229D probably damaging Homo
Ugt1a10 TTCATCA TTCA 1: 88,216,158 probably benign Het
Vmn1r196 T A 13: 22,293,836 V215D probably damaging Homo
Vmn1r22 G T 6: 57,900,332 T220K probably benign Homo
Vmn2r116 G A 17: 23,387,279 M388I possibly damaging Het
Zap70 A G 1: 36,770,811 M1V probably null Homo
Zfp282 A G 6: 47,897,881 D340G probably damaging Homo
Zfp282 T A 6: 47,905,053 I558N possibly damaging Homo
Other mutations in Gpr183
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1653:Gpr183 UTSW 14 121954263 missense probably damaging 1.00
R1856:Gpr183 UTSW 14 121954741 missense probably benign 0.01
R2186:Gpr183 UTSW 14 121954315 missense probably benign 0.00
R2422:Gpr183 UTSW 14 121954177 missense probably damaging 1.00
R4630:Gpr183 UTSW 14 121954849 missense probably damaging 1.00
R4630:Gpr183 UTSW 14 121954850 nonsense probably null
R4670:Gpr183 UTSW 14 121954737 missense probably damaging 1.00
R4671:Gpr183 UTSW 14 121954737 missense probably damaging 1.00
R4976:Gpr183 UTSW 14 121954863 missense possibly damaging 0.88
R5119:Gpr183 UTSW 14 121954863 missense possibly damaging 0.88
R5382:Gpr183 UTSW 14 121954921 missense possibly damaging 0.95
R6952:Gpr183 UTSW 14 121954485 missense possibly damaging 0.62
R7426:Gpr183 UTSW 14 121954744 missense possibly damaging 0.69
R7682:Gpr183 UTSW 14 121954740 missense possibly damaging 0.50
R7722:Gpr183 UTSW 14 121954858 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCGTGAAGTGCAGAGAGATCTG -3'
(R):5'- GGTCTTTGCTCAAACACTGC -3'

Sequencing Primer
(F):5'- ATCTGGAAGGAATGTCTCGCC -3'
(R):5'- TGCTCAAACACTGCCGCTG -3'
Posted On 2016-05-10