Mutagenetix > Incidental Mutation

Incidental Mutation 'S24628:Adgre4'

385675

Institutional Source

Beutler Lab

Gene Symbol

Adgre4

Ensembl Gene

ENSMUSG00000032915

Gene Name

adhesion G protein-coupled receptor E4

Synonyms

Gpr127, EGF-TM7, FIRE, Emr4, D17Ertd479e

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

S24628 () of strain waterfowl

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

55749984-55853662 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 55852288 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 658 (V658I)

Ref Sequence

ENSEMBL: ENSMUSP00000025004 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025004]

AlphaFold

Q91ZE5

Predicted Effect

probably benign
Transcript: ENSMUST00000025004
AA Change: V658I

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000025004
Gene: ENSMUSG00000032915
AA Change: V658I

Domain	Start	End	E-Value	Type
signal peptide	1	36	N/A	INTRINSIC
Blast:EGF_like	38	76	2e-10	BLAST
Pfam:EGF_CA	77	117	3.6e-9	PFAM
GPS	288	338	4.03e-12	SMART
Pfam:7tm_2	343	588	5.7e-57	PFAM
low complexity region	613	628	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176564

Coding Region Coverage

1x: 98.1%
3x: 97.0%
10x: 94.3%
20x: 88.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ccdc40	T	C	11: 119,232,118	Y249H	possibly damaging	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Homo
Gbp4	G	A	5: 105,121,106	R394C	possibly damaging	Het
Gpr183	C	A	14: 121,954,476	C211F	probably damaging	Homo
Lcp1	A	T	14: 75,227,006	I556F	possibly damaging	Het
Letm1	G	A	5: 33,747,444	P513S	probably benign	Het
Letm1	G	A	5: 33,747,446	P512L	probably benign	Het
Msh3	A	G	13: 92,346,786	V283A	possibly damaging	Het
Nfkb2	G	T	19: 46,307,567	E170D	probably benign	Het
Npr3	C	A	15: 11,848,563	M439I	probably benign	Het
Olfr1023	A	T	2: 85,887,438	I213F	possibly damaging	Het
Olfr1034	A	T	2: 86,047,055	H191L	probably benign	Het
Pax5	G	A	4: 44,691,886	A120V	probably damaging	Het
Plcb1	A	G	2: 135,337,499	Y609C	probably damaging	Het
Plxna1	G	A	6: 89,357,336	H104Y	probably benign	Homo
Rnf213	A	T	11: 119,414,469	I509F	probably damaging	Het
Ryr2	T	C	13: 11,869,156	S213G	probably damaging	Homo
Spint1	A	G	2: 119,245,615	T231A	probably damaging	Het
Tbcel	C	A	9: 42,444,500	C139F	probably benign	Het
Thbs2	A	C	17: 14,679,973	S573A	probably benign	Het
Tmem43	C	A	6: 91,482,318	P257Q	probably benign	Homo
Tmprss13	A	G	9: 45,337,132		probably null	Het
Tnc	C	T	4: 64,018,012	G229D	probably damaging	Homo
Ugt1a10	TTCATCA	TTCA	1: 88,216,158		probably benign	Het
Vmn1r196	T	A	13: 22,293,836	V215D	probably damaging	Homo
Vmn1r22	G	T	6: 57,900,332	T220K	probably benign	Homo
Vmn2r116	G	A	17: 23,387,279	M388I	possibly damaging	Het
Zap70	A	G	1: 36,770,811	M1V	probably null	Homo
Zfp282	A	G	6: 47,897,881	D340G	probably damaging	Homo
Zfp282	T	A	6: 47,905,053	I558N	possibly damaging	Homo

Other mutations in Adgre4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Adgre4	APN	17	55791915	splice site	probably benign
IGL00228:Adgre4	APN	17	55802135	missense	probably damaging	1.00
IGL00572:Adgre4	APN	17	55820648	missense	probably benign	0.00
IGL01404:Adgre4	APN	17	55797639	missense	possibly damaging	0.63
IGL01420:Adgre4	APN	17	55799785	splice site	probably benign
IGL01501:Adgre4	APN	17	55802002	splice site	probably benign
IGL01510:Adgre4	APN	17	55818760	critical splice donor site	probably null
IGL01554:Adgre4	APN	17	55817090	missense	probably damaging	1.00
IGL01607:Adgre4	APN	17	55794748	splice site	probably benign
IGL01767:Adgre4	APN	17	55797740	missense	probably benign	0.19
IGL02253:Adgre4	APN	17	55760573	missense	probably benign	0.01
IGL02358:Adgre4	APN	17	55843209	missense	probably benign	0.15
IGL02466:Adgre4	APN	17	55814188	missense	probably benign	0.42
IGL03057:Adgre4	APN	17	55799602	splice site	probably benign
R0070:Adgre4	UTSW	17	55802154	missense	probably damaging	0.98
R0070:Adgre4	UTSW	17	55802154	missense	probably damaging	0.98
R0111:Adgre4	UTSW	17	55817073	missense	possibly damaging	0.92
R0311:Adgre4	UTSW	17	55802010	missense	probably benign	0.36
R0366:Adgre4	UTSW	17	55792001	nonsense	probably null
R0415:Adgre4	UTSW	17	55852288	missense	probably benign	0.03
R0465:Adgre4	UTSW	17	55785137	splice site	probably benign
R0619:Adgre4	UTSW	17	55820679	missense	possibly damaging	0.52
R0685:Adgre4	UTSW	17	55792035	missense	probably benign	0.05
R0724:Adgre4	UTSW	17	55852281	missense	probably benign	0.00
R0835:Adgre4	UTSW	17	55799637	missense	probably damaging	1.00
R1330:Adgre4	UTSW	17	55778814	missense	probably benign	0.36
R1452:Adgre4	UTSW	17	55784996	missense	probably benign	0.35
R1960:Adgre4	UTSW	17	55791497	missense	probably benign
R1961:Adgre4	UTSW	17	55791497	missense	probably benign
R2046:Adgre4	UTSW	17	55778847	missense	possibly damaging	0.82
R2421:Adgre4	UTSW	17	55778872	missense	probably benign	0.10
R2570:Adgre4	UTSW	17	55778878	missense	possibly damaging	0.54
R3162:Adgre4	UTSW	17	55802218	splice site	probably benign
R4222:Adgre4	UTSW	17	55785121	missense	probably damaging	1.00
R4526:Adgre4	UTSW	17	55785016	nonsense	probably null
R4631:Adgre4	UTSW	17	55814305	missense	probably null	1.00
R4689:Adgre4	UTSW	17	55802096	missense	probably damaging	1.00
R4701:Adgre4	UTSW	17	55784971	missense	probably damaging	1.00
R4792:Adgre4	UTSW	17	55791491	missense	probably benign	0.00
R5205:Adgre4	UTSW	17	55794727	nonsense	probably null
R5210:Adgre4	UTSW	17	55785029	missense	probably damaging	0.97
R5358:Adgre4	UTSW	17	55818758	missense	probably benign	0.00
R5873:Adgre4	UTSW	17	55852282	missense	probably benign	0.13
R6025:Adgre4	UTSW	17	55792013	missense	probably benign	0.00
R6257:Adgre4	UTSW	17	55802133	missense	possibly damaging	0.87
R6426:Adgre4	UTSW	17	55802196	missense	probably benign	0.18
R6440:Adgre4	UTSW	17	55794744	critical splice donor site	probably null
R6484:Adgre4	UTSW	17	55802036	missense	possibly damaging	0.52
R6680:Adgre4	UTSW	17	55791959	missense	probably benign	0.09
R7086:Adgre4	UTSW	17	55820649	missense	probably benign	0.00
R7442:Adgre4	UTSW	17	55852340	missense	probably benign	0.04
R7467:Adgre4	UTSW	17	55791952	missense	probably benign	0.00
R7875:Adgre4	UTSW	17	55792016	missense	probably benign	0.00
R8007:Adgre4	UTSW	17	55814233	missense	probably damaging	0.99
R8096:Adgre4	UTSW	17	55820700	missense	probably damaging	1.00
R8172:Adgre4	UTSW	17	55797769	missense	probably benign	0.00
R8512:Adgre4	UTSW	17	55818760	critical splice donor site	probably null
R8972:Adgre4	UTSW	17	55802189	missense	probably damaging	1.00
R9018:Adgre4	UTSW	17	55791993	missense	probably benign	0.00
R9049:Adgre4	UTSW	17	55785094	missense	probably benign	0.05
X0010:Adgre4	UTSW	17	55814308	missense	probably damaging	1.00
Z1177:Adgre4	UTSW	17	55814152	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- ATAGGTAGCCAAGGGATTTATTTGC -3'
(R):5'- CTAGCAATTATAGCTTCATGTGCATGG -3'

Sequencing Primer
(F):5'- TGGACTTGTTTGACCTTTATCAATC -3'
(R):5'- AAGCGTGAGTACCTGAGT -3'

Posted On

2016-05-10